downloaded from //s3-eu-west-1.amazonaws.com/awarticles/27381395.pdf · 162 (tecnolab-ab, buenos...

1

Title: Aspergillus fumigatus intrinsic fluconazole resistance is due to 1

the naturally occurring T301I substitution in Cyp51Ap. 2

Florencia Leonardelli 1,2, Daiana Macedo 1, Catiana Dudiuk 1,2, Matias S. 3

Cabeza 1,2, Soledad Gamarra 1, Guillermo Garcia-Effron # 1,2. 4

1 Laboratorio de Micología y Diagnóstico Molecular - Cátedra de 5

Parasitología y Micología – Facultad de Bioquímica y Ciencias Biológicas 6

– Universidad Nacional del Litoral. Santa Fe (Argentina). 7

2 Consejo Nacional de Investigaciones Científicas y Tecnológicas 8

(CONICET). CCT-Santa Fe (Argentina). 9

10

Key words: Aspergillus fumigatus, Fluconazole, Intrinsic Resistance 11

Mechanism, Azole resistance. 12

13

# Corresponding author: Dr. Guillermo Garcia-Effron. Laboratorio de 14

Micología y Diagnóstico Molecular (CONICET) – Cátedra de Parasitología y 15

Micología – Facultad de Bioquímica y Ciencias Biológicas – Universidad 16

Nacional del Litoral - Ciudad Universitaria – Paraje el Pozo S/N – Santa 17

Fe (Santa Fe) – CP 3000 – Argentina. 18

e-mail: [email protected] Phone: +54-342-4575209 int. 135. Fax: +54-19

342-4575216. 20

21

Running title: Fluconazole resistance mechanism in A. fumigatus. 22

23

AAC Accepted Manuscript Posted Online 5 July 2016Antimicrob. Agents Chemother. doi:10.1128/AAC.00905-16Copyright © 2016, American Society for Microbiology. All Rights Reserved.

on July 19, 2016 by University of M

anchester Libraryhttp://aac.asm

.org/D

ownloaded from

http://aac.asm.org/

2

Abstract 24

Aspergillus fumigatus intrinsic fluconazole-resistance has been 25

demonstrated to be linked to the CYP51A gene, although the precise 26

molecular mechanism has not been elucidated yet. Comparisons between A. 27

fumigatus Cyp51Ap and Candida albicans Erg11p sequences showed 28

differences in amino acid residues already associated with fluconazole 29

resistance in C. albicans. The aim of this study was to analyze the role 30

of the natural polymorphism I301 in the Aspergillus fumigatus Cyp51Ap in 31

the intrinsic fluconazole resistance phenotype of this pathogen. The 32

I301 residue at the A. fumigatus Cyp51Ap was replaced with a threonine 33

(analogue to T315 at Candida albicans fluconazole-susceptible Erg11p) by 34

changing one single nucleotide in CYP51A gene. Also a CYP51A knock out 35

strain was obtained using the same parental strain. Both mutant’s 36

antifungal susceptibilities were tested. The I301T mutant exhibited a 37

lower level of resistance to fluconazole (MIC 20 µg/ml) than the 38

parental strain (MIC 640 µg/ml) while no changes in MIC values were 39

observed for other azole and non-azole based drugs. This data strongly 40

implicate the A. fumigatus Cyp51Ap I301 residue in the intrinsic 41

resistance to fluconazole. 42

43

44



.org/D

ownloaded from

http://aac.asm.org/

3

Introduction 45

Aspergillus fumigatus is the most common hyphomycete to cause disease in 46

humans (1-3). It is intrinsically resistant to ketoconazole and 47

fluconazole but normally susceptible to the other available azole 48

antifungal agents (itraconazole, posaconazole, voriconazole and 49

isavuconazole) (4-8). The molecular mechanism for fluconazole intrinsic 50

resistance has not been described yet. However, a hypothetical molecular 51

mechanism has been proposed by Edlind et al. who linked A. fumigatus 52

fluconazole intrinsic resistance with a naturally occurring amino acid 53

substitution in Cyp51Ap (14-α sterol demethylase A) (9). These authors 54

carried out an in silico comparison of the Candida albicans Erg11p and 55

A. fumigatus Cyp51Ap sequences and found that among the residues most 56

commonly implicated in fluconazole-resistance in C. albicans (Y132, 57

T315, S405, G464 and R467) (10,11), only the T315 residue is not 58

conserved in A. fumigatus Cyp51Ap and is naturally replace by a non-59

polar isoleucine (I301). In C. albicans, the substitution of the polar 60

T315 residue by the non-polar alanine (T315A) is enough to confer 61

fluconazole resistance to the yeast (10). 62

The aim of this study was to molecularly confirm that the natural 63

polymorphism I301 in the Cyp51Ap is necessary and sufficient to explain 64

the fluconazole intrinsic reduced susceptibility of A. fumigatus. An A. 65

fumigatus mutant harboring the I301T substitution was generated and 66

susceptibilities to fluconazole and other antifungals were tested. Also 67

a CYP51A-defective mutant was obtained using the same parental strain in 68

order to compare their antifungal susceptibility patterns. 69

70



.org/D

ownloaded from

http://aac.asm.org/

4

71

MATERIALS AND METHODS 72

Strains. Aspergillus fumigatus akuBKU80 (12) was considered the wild-type 73

strain and its DNA was used as template for all the PCRs. It was the 74

recipient strain for electroporation assays. Escherichia coli TOP10 75

(Promega) was used to propagate all plasmids. 76

77

Genetic constructs. A transformation plasmid named LMDM-P87 was 78

generated. It contains a mutated T973C CYP51A gene (that leads to the 79

amino acid substitution I301T in Cyp51Ap) with its intact 5’ flanking 80

region. The CYP51A 3’UTR region is interrupted by a hygromycin B 81

resistance cassette (hph) between nucleotides 126 and 127 upstream the 82

CYP51A stop codon. Plasmid LMDM-P87 was obtained in two sets of three 83

PCR reactions each (Figure 1). The first set was aimed to introduce the 84

mutation T973C to the CYP51A. In the first reaction of this set, primers 85

A7 and A19 were used to amplify a 1452 bp fragment which contained a 462 86

bp of the CYP51A promotor region plus 990 bp of the first portion of its 87

coding sequence (5´ UTR region and 5’ of the ORF). The second PCR 88

employed the oligonucleotides A18 and A17, which amplify a 790 bp 89

fragment including 664 bp of the 3’ portion of the CYP51A ORF and 126 bp 90

upstream of the CYP51A stop codon (3’UTR region). The primer A18 carries 91

the mutation T973C in the middle of its sequence. The primer A19 is 92

reverse complementary with A18 and both generate an overlapping region 93

of 35 bp which was used in the following fusion-PCR. The final reaction 94

was performed using the primers A7-A17 and the two previously generated 95

fragments (1452 bp and 790 bp) as templates. The resulting 2.2 kb 96



.org/D

ownloaded from

http://aac.asm.org/

5

product was cloned into the pGEM-T Easy Vector (Promega) to obtain the 97

plasmid LMDM-P75. Both strands of the complete 2.2 kb construct were 98

sequenced to confirm the presence of the mutation, as described 99

previously (13). In parallel a second set of PCR reactions was 100

performed. The hph cassette was fused to a 0.9 Kb fragment of the 3’UTR 101

region of CYP51A starting 127 bp upstream the CYP51A stop codon. The 102

resistance cassette was used as selection marker for recombinants while 103

the 0.9 Kb fragment was used later as flanking region for homologous 104

integration together with the 5’UTR-CYP51A In the first PCR 105

amplification of this set, the 1.4 kb hph cassette was obtained from the 106

plasmid pUM102 (A. fumigatus CYP51AΔhph) (a kind gift of Dr. Emilia 107

Mellado) (14) using the primers H1 and HF2. The second PCR was performed 108

using the primers HF1 and H2 in order to obtain the 0.9 kb fragment of 109

the 3’UTR region of CYP51A gene described before. HF1 and HF2 are 110

reverse complementary primers designed to allow the fusion of the 111

described fragments in the next reaction. The last PCR of this set was 112

done using the 1.4 kb (hph) and the 0.9 kb fragments as templates and 113

the primers H1 and H2. These last oligonucleotides include a SacI site 114

on both ends. The resulting construct (2.3 kb) was cloned into a pGEM-T 115

Easy Vector to obtain the plasmid LMDM-P82. 116

To generate the complete transformation vector, the 2.3 kb fragment with 117

hph cassette was released from the LMDM-P82 by SacI digestion following 118

manufacturer’s instructions (Promega). Simultaneously, LMDM-P75 was 119

linearized with SacI and dephosphorylated using Calf Intestinal Alkaline 120

Phosphatase (CIAP, Promega) according to the manufacturer’s protocol. 121

Afterwards, the 2.3 kb fragment was ligated with T4-DNA ligase (Promega) 122



.org/D

ownloaded from

http://aac.asm.org/

6

to the linearized LMDM-P75 to create LMDM-P87. The complete vector 123

sketch can be seen in figure 1. Primer sequences are described in table 124

1. 125

126

Transformations. Two linear PCR fragments were used for A. fumigatus 127

akuBKU80 transformation: (i) the cassette containing the mutated CYP51A 128

gene together with the hph selection marker (LMDM-P87) and (ii) the 129

CYP51A knock out cassette (14). Fragments were PCR-amplified with the 130

primer pairs A7/H2 and P450.1/P450.2, respectively. Transformation 131

experiments by electroporation were carried out as described before 132

(13)using 0.3 µg of the PCR fragments. Transformants were selected with 133

350 µg/ml of hygromycin B (HygB) (InvivoGen) in minimum medium (MM) (15) 134

and subcultured for further analysis. The incorporation of the hph 135

cassette was phenotypically confirmed by plating the strains in 136

duplicate in MM with 350 µg/ml HygB. 137

138

Integration confirmation. Genomic DNA from HygB-resistant transformants 139

and the parental strain were obtained (14). Two multiplex-PCR reactions 140

were performed to confirm the homologous recombination of the mutated 141

CYP51A/hph cassette and the knock-out cassette (Figure 2A). The first 142

multiplex reaction was performed with two primer pairs and it was aimed 143

to verify the integration of the hph cassette in the A. fumigatus 144

genome. Primers A7 and A10 were used as PCR reaction control as they 145

hybridize the 5´UTR and the ORF of the CYP51A, respectively. Primers HS3 146

and HS4 were used to amplify a fragment of the hph cassette. Thus, two 147

PCR fragments were expected when the hph cassette was integrated (1066 148



.org/D

ownloaded from

http://aac.asm.org/

7

bp and 386 bp). Contrariwise, only the 1066 bp fragment would be 149

amplified in non-transformant strains. The second multiplex PCR reaction 150

was meant to confirm the homologous recombination of the mutated CYP51A, 151

using the primers A14, HS3 and HS4. Primer A14 was designed to hybridize 152

the CYP51A 5’ flanking region 603 bp downstream the CYP51A start codon, 153

which is outside the construction cloned into the LMDM-P87. Homologous 154

or ectopic recombination would be confirmed by the amplification of two 155

fragments (3.5 kb and 386 bp) or one (386 bp) band, respectively. No 156

bands were expected in non-transformant strains. 157

158

PCR reactions. PCR amplifications were performed in a 25 µl volume 159

following the Pegasus DNA polymerase (PBL, Buenos Aires, Argentina) 160

manufacturer´s instructions in an Applied Biosystems thermocycler 161

(Tecnolab-AB, Buenos Aires, Argentina). The thermocycler was programed 162

for one initial step of 2 min at 94°C followed by 30 cycles of 30 s at 163

95°C, 30 s at primer´s pair Tm, and 1 min per Kb of the expected PCR 164

product at 72°C and then a final cycle of 10 min at 72ºC. 165

166

Confirmation of the expression of the mutated CYP51A. Total RNA was 167

extracted with RNAzol (RNAzol®RT – MRC Inc.) from mutant strains and 168

retro transcription (RT) was performed with AMV-RT enzyme (Promega, 169

Argentina) according to the manufacturer’s protocol. The obtained cDNA 170

was used as template for a PCR reaction performed with primers A1 – A10 171

(flanking the 70 bp intron of CYP51A). 172

173



.org/D

ownloaded from

http://aac.asm.org/

8

Antifungal susceptibility testing. Susceptibility testing was performed 174

following the broth microdilution reference method published in the 175

document M38-A2 of the Clinical and Laboratory Standards Institute 176

(CLSI) (16). Itraconazole , posaconazole , voriconazole , fluconazole, 177

amphotericin B and caspofungin (all purchased in Sigma-Aldrich, 178

Argentina) were tested. Concentration ranges of fluconazole were 179

modified from what is standardized to 640 – 1.25 µg/ml to establish 180

differences in fluconazole susceptibilities between wild type and mutant 181

strains. Moreover, fluconazole and voriconazole susceptibility were also 182

evaluated by disk diffusion following the CLSI document M51-A (17) using 183

commercial disks (Oxoid, Argentina) and by agar diffusion using 184

fluconazole MIC-test strips (fluconazole 256 µg – MIC Test Strips – 185

Liofilchem ® SRL). Susceptibility tests were performed in triplicate in 186

three different days.187



.org/D

ownloaded from

http://aac.asm.org/

1

RESULTS 188

189

To establish the role of the I301 residue of the Cyp51Ap in the A. fumigatus 190

intrinsic fluconazole resistance, two mutant strains were generated. One 191

harbors the mutation T793C in the CYP51A that leads to the I301T amino acid 192

substitution while the other is a CYP51A defective strain. Mutants were 193

named LMDM-1030 and LMDM-32, respectively. The homologous recombination was 194

confirmed by multiplex PCR using the primers described in material and 195

methods. The mutant strains LMDM-1030 and LMDM-32 showed the genomic 196

integration of the hph cassette (figure 2B-lanes 4 and 5, respectively). In 197

both mutants, two PCR bands were observed (386 bp and 1066 bp) corresponding 198

to the amplification of the DNA region between primers HS3/HS4 and A7/A10, 199

respectively. Similar results were obtained using LMDM-P87 and pUM-102 DNAs 200

which were used as reaction controls. On the other hand, parental strain 201

akuBKU80 showed only one 1066 bp band. The homologous recombination of both 202

constructions in LMDM-1030 and LMDM-32 were confirmed by a second multiplex 203

PCR. Two PCR bands were obtained when DNAs from both mutants were used 204

(Figure 2B- lanes 8 and 9). LMDM-1030 showed a 3.5 kb and a 386 bp bands 205

which correspond to the amplification using the primers A14 and HS4 and the 206

pair HS4 and HS3, respectively. The smaller band shows the hph presence. The 207

3.5 kb band demonstrate that the construction was integrated replacing the 208

wild type CYP51A since the A14 primer hybridize the CYP51A 5´UTR but in a 209

region not included in the construction (A14 hybridize 603 bp upstream of 210

the start codon). Moreover, the size of the amplicon demonstrate that the 211

hph cassette was integrated in the 3´UTR, 126 bp upstream of the CYP51A stop 212

codon. For LMDM-32, the multiplex PCR also showed two bands but with 213



.org/D

ownloaded from

http://aac.asm.org/

2

different sizes (2.4 kb and 386 bp). The smaller band demonstrate the hph 214

cassette integration as described before, while the 2.4 kb band shows that 215

the hph cassette was integrated inside the CYP51A ORF region. As expected, 216

when A. fumigatus akuBKU80 DNAs was used no amplification was obtained 217

(Figure 2B- line 6). The incorporation of the T973C mutation in the CYP51A 218

gene of the LMDM-1030 mutant strain was confirmed by sequencing (Figure 2C). 219

The naturally occurring polymorphism T301I at A. fumigatus Cyp51Ap is 220

responsible of the fluconazole-resistance phenotype. The CYP51A defective 221

strain LMDM-32 and the T973C mutant LMDM-1030 were morphologically 222

indistinguishable from its parental strain A. fumigatus akuBKU80. However, 223

azole MIC values were substantially different. It was clear that the 224

deletion of CYP51A in LMDM-32 decreased the azole MIC values 32- to 4-fold 225

for fluconazole and the other azole drugs tested, respectively. In contrast, 226

LMDM-1030 MIC values were significantly lower only for fluconazole (32-fold) 227

(Table 2). As expected, there were no susceptibility differences to non-228

azole antifungals between mutants and parental strains (Table 2). The 229

fluconazoleand voriconazole susceptibility differences between wild type and 230

mutant strains were confirmed by Disk diffusion susceptibility testing. The 231

parental strain showed no inhibition zone when fluconazole disks were used 232

while the inhibition zone diameter for both mutant strains was 19 mm. 233

Turning to voriconazole, parental and LMDM-1030 strains showed the same 234

inhibition diameter (32 mm.) whereas the knock out mutant showed an 235

inhibition zone of 48 mm. (Table 2 and figure 3). Moreover, fluconazole MIC 236

differences between akuBKU80 and both mutants were also verified by agar 237

diffusion using Liofilchem MIC-test strips. Using this methodology, akuBKU80 238



.org/D

ownloaded from

http://aac.asm.org/

3

strain showed a MIC of >256 µg/ml while both mutants exhibited 8 µg/ml (64-239

fold lower) (Table 2 and Figure 4). 240

CYP51A gene expression in LMDM-1030. The construction transformed into 241

LMDM-1030 carried a mutated CYP51A ORF with a 3´UTR modification (hph 242

insertion). The genomic integration of the construction could alter the 243

CYP51A gene transcription into mRNA, producing a decreased azole MIC 244

phenotype as the observed in CYP51A knock out strains (14). LMDM-1030 and 245

LMDM-32 strains showed low fluconazole MIC value. Thus, we decided to 246

evaluate the CYP51A expression during hyphal growth in order to determine 247

whether a loss of CYP51A expression might cause or contribute to the 248

fluconazole MIC change. Total RNA from akuBKU80 and LMDM-1030 strains were 249

extracted and retro-transcription reactions were carried out. Afterwards, 250

genomic DNA and cDNA from both strains were used as templates of PCR 251

reactions performed with the primers A1 and A10. These oligonucleotides 252

hybridize areas surrounding the intron of the CYP51A gene. Hence, fragments 253

of 350 bp and 425 bp were observed when cDNA and DNA from both strains were 254

used as template confirming the presence of CYP51A mRNA in both strains 255

(Figure 3). 256

257

Discussion 258

It is well known that A. fumigatus is intrinsically resistant to 259

fluconazolefluconazole and ketoconazole and normally susceptible to the 260

other available azole drugs (5,8). However, clinical secondary azole 261

resistance was described and mostly associated with several amino acid 262

substitution at Cyp51Ap (4,13,14,18-26). In 2005, Mellado et al. reported a 263

CYP51AΔ A. fumigatus mutant which was azole hyper-susceptible, confirming 264



.org/D

ownloaded from

http://aac.asm.org/

4

the linkage between CYP51A and azole resistance (14). It is also clear that 265

each particular amino acid substitution in Cyp51Ap (or the combination of 266

them) leads to a particular azole MIC pattern and that most of the reported 267

CYP51A mutant strains showed itraconazole-resistance, itraconazole-268

posaconazole cross resistance, isavuconazole-voriconazole cross resistance 269

or pan-triazole cross resistance (4,13,14,18-26). Despite the advances in 270

elucidating the secondary azole resistance mechanisms in A. fumigatus, the 271

molecular basis of fluconazole intrinsic resistance was never studied. The 272

first hypothesis regarding this subject was proposed by Edlind et al. 273

studying A. fumigatus Cyp51Ap sequence (9). They suggested that the Cyp51Ap 274

I301 residue could be implicated in fluconazole-resistance since the T315A 275

substitution in the C. albicans Erg11p produce a similar phenotype. Later, 276

Diaz-Guerra et al. gave the first laboratory clue linking fluconazole 277

resistance with Cyp51Ap. They described that amino acid substitutions at the 278

G54 residue of the Cyp51Ap lead to itraconazole resistance but 4- to 5-fold 279

fluconazole MIC values reductions possibly due to a better interaction 280

between fluconazole and Cyp51Ap (13). 281

In this work, we obtained two A. fumigatus mutants, one harboring a I301T 282

substitution at its Cyp51Ap while the other is a CYP51A deletant. Both 283

mutants showed a 32-fold decrease in fluconazole MIC. To establish that 284

fluconazole susceptibility in the engineered A. fumigatus mutant is due to 285

the I301T change and not due to the loss of CYP51A, the expression of this 286

gene during hyphal growth was confirmed by retro-transcription. The MIC 287

values obtained for the other azole tested drugs also confirm that I301T 288

substitution is necessary and sufficient to explain fluconazole MIC 289

reduction. LMDM-1030 strain alone showed similar voriconazole, posaconazole 290



.org/D

ownloaded from

http://aac.asm.org/

5

and itraconazole MIC to those obtained for its parental strain mimicking C. 291

albicans susceptibility patterns (pan-azole susceptibility) (27). 292

The precise manner in which I301T substitution impacts in fluconazole 293

susceptibility could be explained taking into account that in A. fumigatus 294

there are two homologous 14-CYP51 genes (28). In both Cyp51ps, four of the 295

five residues most frequently linked with fluconazole-resistance in C. 296

albicans are conserved (Y132, T315, S405, G464 and R467) (10,11). 297

Consequently, these amino-acid would not account for fluconazole resistance 298

in A. fumigatus. The fifth residue (T315) is conserved only in Cyp51Bp while 299

in Cyp51Ap is naturally replaced (I301). LMDM-1030 mutant harbors in both 300

Cyp51ps a threonine, as in C. albicans, thus both enzymes would be inhibited 301

by fluconazole. The T315 residue in the C. albicans 14-α sterol demethylase 302

is crucial for the correct enzyme-substrate and enzyme–drug interactions 303

near the haem group (11,29). Analogously, the A. fumigatus Cyp51Ap I301 is 304

placed in the center the α-I loop (D280-Q312) which was proposed as 305

essential for drug-enzyme interaction (30-35). Recently, Hargrove et al. 306

reported A. fumigatus Cyp51Bp crystal structure complexes obtained with and 307

without voriconazole. They confirmed that the residue T315 (equivalent to 308

I301 in Cyp51Ap) is part of the N-terminal portion of one of the substrate 309

recognition sequence (SRS4) which showed fungus-specific features not 310

observed in Cyp51p from other kingdoms. This data demonstrated the 311

importance of SRS4 in the specific inhibition of sterol biosynthesis in 312

fungi by azole drugs (31). Moreover, at the beginning of 2016, Liu et al. 313

reported a 3D structural model of the A. fumigatus Cyp51Ap based on a 314

crystal structure of the homologous Saccharomyces cerevisiae enzyme (Erg11p) 315

(32). Itraconazole, voriconazole and posaconazole were docked to wild type 316



.org/D

ownloaded from

http://aac.asm.org/

6

and mutant Cyp51Ap and their model demonstrate that the S297 residue (part 317

of the αI helix) is adjacent to haem group and would interact with ligands 318

and azoles (32). When the Cyp51Ap αI helix is represented as a helical wheel 319

diagram, the I301 residue is the closest amino acid to S297 and would also 320

interact with azoles (data not shown). The experimental data that we present 321

in this work supports Liu et al. and Edlind et al. results (9, 32) and 322

strongly implicate the Cyp51Ap I301 residue in the A. fumigatus intrinsic 323

resistance to fluconazole. Moreover, this knowledge may help to understand 324

how the drugs interact with Cyp51Ap and would help in the development of new 325

antifungals. 326

327



.org/D

ownloaded from

http://aac.asm.org/

7

Figure legends 328

329

Figure 1: Construction of the LMDM-P87 plasmid employed to generate the 330

A. fumigatus CYP51A T973C mutant strain. Striped and grey boxes represent 331

the CYP51A coding and UTRs sequences, respectively. Unfilled boxes indicate 332

the hygromycin resistance cassette (hph) obtained from the pUM102 plasmid. 333

Black arrows symbolize oligonucleotide primers. The X symbol represents the 334

introduced T973C mutation. SacI restriction sites are indicated with 335

scissors (primers H1 and H2). 336

Figure 2: Recombination confirmation. A) Schematic representation of the 337

gene constructions and primers relative positions. Striped and grey boxes 338

represent the CYP51A coding and UTRs sequences, respectively. Unfilled boxes 339

indicate the hygromycin resistance cassette (hph). Black boxes show the 340

CYP51A UTRs not included in the constructions. Lines (in LMDM-P87 and pUM-341

102) represent pGemT-easy vector. Arrows symbolize oligonucleotide primers. 342

The X symbol represents the introduced T973C mutation. Dotted lines 343

represent the size (in bp) of the PCR fragments. B) Multiplex PCR reactions 344

aimed to confirm homologous recombination events in the studied mutants. 345

Lanes 1 to 5 show the results of the multiplex PCR designed to verify the 346

hph cassette integration (primers A7/A10 and HS3/HS4). Lanes 6 to 10 show 347

the amplification products of the multiplex PCR meant to confirm the 348

homologous recombination of the mutated CYP51A (primers A14, HS3 and HS4). 349

M: 100 bp ladder. Lanes 1 and 6: Wild type akuBKU80. Lanes 2 and 7: LMDM-P87. 350

Lanes 3 and 8: LMDM-1030. Lanes 4 and 9: LMDM-32. Lanes 5 and 10: pUM-102. 351



.org/D

ownloaded from

http://aac.asm.org/

8

C) Sequencing chromatograms showing the mutation T973C at the CYP51A gene of 352

the LMDM-1030 strain. 353

354

Figure 3: Agarose gel electrophoresis showing the detection of CYP51A 355

transcripts. Lanes 1 and 2, PCR products using genomic DNAs. Lanes 3 and 4, 356

PCR amplification using cDNAs as template. Lanes 1 and 3, A. fumigatus 357

akuBKU80. Lanes 2 and 4, LMDM-1030. 358

359

Figure 4: Diffusion susceptibility testing using fluconazole (FLC) disks and 360

Liofilchem MIC test strips and voriconazole (VRC) disks for A. fumigatus 361

LMDM-1030 (I301T Cyp51Ap mutant), A. fumigatus akuBKU80 (parental strain) and 362

A. fumigatus LMDM-32 (CYP51AΔ). 363

364



.org/D

ownloaded from

http://aac.asm.org/

1

365

Table 1. Oligonucleotide primers used in this work. 366

367

Primer Sequence (5’- 3’) * Orientation Use

A7 1 TCATATGTTGCTCAGCGG Sense LMDM-P87 construction and evaluation of the transforming vector integration.

A19 GCATAATCCAGGCGCTGGTGGACGAAGACGAATGC Antisense LMDM-P87 construction.A18 GCATTCGTCTTCGTCCACCAGCGCCTGGATTATGC Sense LMDM-P87 construction.A17 GGCCAGTAAGGTCTGAATAAG Antisense LMDM-P87 construction.H1 TTTGAGCTCGTTAACTGATATTGAAGGAGCATTTTTTGGGC Sense LMDM-P87 construction.H2 ACGGAGCTCCATCGAACCTCTCGTGTGACTATG Antisense LMDM-P87 construction.HF1 AGAGTAGATGCCGACCGGGAACCAGTTAACCCTGAAGTGTTGTTGCCTATACTGAG Sense LMDM-P87 construction.HF2 CTCAGTATAGGCAACAACACTTCAGGGTTAACTGGTTCCCGGTCGGCATCTACTCT Antisense LMDM-P87 construction.P450-1 2 ATGGTGCCGATGCTATGG Sense CYP51A knock-out cassette amplification. P450-2 2 CTGTCTCACTTGGATGTG Antisense CYP51A knock-out cassette amplification.

A10 ATTGCCGCAGAGATGTCC Antisense Evaluation of the transforming vector integration and CYP51A expression.

HS3 ACATGGCGTGATTTCATATGCGCG Sense Evaluation of the transforming vector integration.

HS4 TGGTCAAGACCAATGCGGAGCATA Antisense Evaluation of the transforming vector integration.

A14 CCAGAGAGACTTTGACACAG Sense

Evaluation of the transforming vector integration.

A1 1 CTTCTTTGCGTGCAGAGA Sense Evaluation of CYP51A expression. 368

* Letters in bold indicate the mutated nucleotide. Underlining indicates a SacI restriction site. 369

1 Mellado et al. (28) 370

2 Diaz-Guerra et al. (13) 371

372



.org/D

ownloaded from

http://aac.asm.org/

1

Table 2: Susceptibility testing results of the Aspergillus fumigatus 373

strains used in this study. 374

Antifungal agent a Strains FLC ITC PCZ VRC AMB CSF A. fumigatus akuBKU80

640.00 (>256.00/0)

0.12 0.250.12 (ND/32)

0.50 0.06

LMDM-1030 20.00 (8.00/19)

0.06 0.250.12 (ND/32)

0.50 0.06

LMDM-32 20.00 (8.00/19)

0.03 0.060.03 (ND/48)

0.50 0.06

a Geometric mean of at least 3 repetitions performed in different days. 375

MIC values expressed in µg/ml. FLC: Fluconazole, ITC: Itraconazole, PCZ: 376

Posaconazole, VRC: Voriconazole, AMB: Amphotericin B, CSF: Caspofungin. In 377

parenthesis are the MIC and diameter values obtained by agar diffusion for 378

fluconazole and voriconazole (Liofilchem MIC test strips/inhibition diameter 379

in mm.). ND: Not done. 380

381

382

383

384

ACKNOWLEDGMENTS 385

This study was supported in part by Science, Technology and Productive 386

Innovation Ministry (MinCyT - Argentina) grant PICT2013/1571 to G.G.E. C.D. 387

and F.L. have a fellowship from CONICET (Argentina). D.M. has a fellowship 388

from MinCyT (Argentina). M.S.C. has a postdoctoral fellowship from CONICET. 389

390



.org/D

ownloaded from

http://aac.asm.org/

2

391

392

Reference List 393

394

1. Doligalski, C. T., K. Benedict, A. A. Cleveland, B. Park, G. Derado, P. 395 G. Pappas, J. W. Baddley, D. W. Zaas, M. T. Harris, and B. D. Alexander. 396 2014. Epidemiology of invasive mold infections in lung transplant 397 recipients. Am.J.Transplant. 14:1328-1333. doi:10.1111/ajt.12691 [doi]. 398

2. Pappas, P. G., B. D. Alexander, D. R. Andes, S. Hadley, C. A. Kauffman, 399 A. Freifeld, E. J. Anaissie, L. M. Brumble, L. Herwaldt, J. Ito, D. P. 400 Kontoyiannis, G. M. Lyon, K. A. Marr, V. A. Morrison, B. J. Park, T. F. 401 Patterson, T. M. Perl, R. A. Oster, M. G. Schuster, R. Walker, T. J. 402 Walsh, K. A. Wannemuehler, and T. M. Chiller. 2010. Invasive fungal 403 infections among organ transplant recipients: results of the Transplant-404 Associated Infection Surveillance Network (TRANSNET). Clin.Infect.Dis. 405 50:1101-1111. doi:10.1086/651262 [doi]. 406

3. Steinbach, W. J., K. A. Marr, E. J. Anaissie, N. Azie, S. P. Quan, H. U. 407 Meier-Kriesche, S. Apewokin, and D. L. Horn. 2012. Clinical epidemiology 408 of 960 patients with invasive aspergillosis from the PATH Alliance 409 registry. J.Infect. 65:453-464. doi:S0163-4453(12)00220-4 410 [pii];10.1016/j.jinf.2012.08.003 [doi]. 411

4. Garcia-Effron, G., A. Dilger, L. Alcazar-Fuoli, S. Park, E. Mellado, and 412 D. S. Perlin. 2008. Rapid detection of triazole antifungal resistance in 413 Aspergillus fumigatus. J.Clin.Microbiol. 46:1200-1206. doi:JCM.02330-07 414 [pii];10.1128/JCM.02330-07 [doi]. 415

5. Gregson, L., J. Goodwin, A. Johnson, L. McEntee, C. B. Moore, M. 416 Richardson, W. W. Hope, and S. J. Howard. 2013. In vitro susceptibility 417 of Aspergillus fumigatus to isavuconazole: correlation with 418 itraconazole, voriconazole, and posaconazole. Antimicrob.Agents 419 Chemother. 57:5778-5780. doi:AAC.01141-13 [pii];10.1128/AAC.01141-13 420 [doi]. 421

6. Pfaller, M. A., D. J. Diekema, M. A. Ghannoum, J. H. Rex, B. D. 422 Alexander, D. Andes, S. D. Brown, V. Chaturvedi, A. Espinel-Ingroff, C. 423 L. Fowler, E. M. Johnson, C. C. Knapp, M. R. Motyl, L. Ostrosky-424 Zeichner, D. J. Sheehan, and T. J. Walsh. 2009. Wild-type MIC 425 distribution and epidemiological cutoff values for Aspergillus fumigatus 426 and three triazoles as determined by the Clinical and Laboratory 427 Standards Institute broth microdilution methods. J.Clin.Microbiol. 428 47:3142-3146. doi:JCM.00940-09 [pii];10.1128/JCM.00940-09 [doi]. 429



.org/D

ownloaded from

http://aac.asm.org/

3

7. Rodriguez-Tudela, J. L., L. Alcazar-Fuoli, E. Mellado, A. Alastruey-430 Izquierdo, A. Monzon, and M. Cuenca-Estrella. 2008. Epidemiological 431 cutoffs and cross-resistance to azole drugs in Aspergillus fumigatus. 432 Antimicrob.Agents Chemother. 52:2468-2472. doi:AAC.00156-08 433 [pii];10.1128/AAC.00156-08 [doi]. 434

8. Walsh, T. J., E. J. Anaissie, D. W. Denning, R. Herbrecht, D. P. 435 Kontoyiannis, K. A. Marr, V. A. Morrison, B. H. Segal, W. J. Steinbach, 436 D. A. Stevens, J. A. van Burik, J. R. Wingard, and T. F. Patterson. 437 2008. Treatment of aspergillosis: clinical practice guidelines of the 438 Infectious Diseases Society of America. Clin.Infect.Dis. 46:327-360. 439 doi:10.1086/525258 [doi]. 440

9. Edlind, T. D., K. W. Henry, K. A. Metera, and S. K. Katiyar. 2001. 441 Aspergillus fumigatus CYP51 sequence: potential basis for fluconazole 442 resistance. Med.Mycol. 39:299-302. 443

10. Lamb, D. C., D. E. Kelly, W. H. Schunck, A. Z. Shyadehi, M. Akhtar, D. 444 J. Lowe, B. C. Baldwin, and S. L. Kelly. 1997. The mutation T315A in 445 Candida albicans sterol 14alpha-demethylase causes reduced enzyme 446 activity and fluconazole resistance through reduced affinity. 447 J.Biol.Chem. 272:5682-5688. 448

11. Marichal, P., L. Koymans, S. Willemsens, D. Bellens, P. Verhasselt, W. 449 Luyten, M. Borgers, F. C. Ramaekers, F. C. Odds, and H. V. Bossche. 450 1999. Contribution of mutations in the cytochrome P450 14alpha-451 demethylase (Erg11p, Cyp51p) to azole resistance in Candida albicans. 452 Microbiology 145 (Pt 10):2701-2713. 453

12. da Silva Ferreira, M. E., M. R. Kress, M. Savoldi, M. H. Goldman, A. 454 Hartl, T. Heinekamp, A. A. Brakhage, and G. H. Goldman. 2006. The 455 akuB(KU80) mutant deficient for nonhomologous end joining is a powerful 456 tool for analyzing pathogenicity in Aspergillus fumigatus. Eukaryot.Cell 457 5:207-211. doi:5/1/207 [pii];10.1128/EC.5.1.207-211.2006 [doi]. 458

13. Diaz-Guerra, T. M., E. Mellado, M. Cuenca-Estrella, and J. L. Rodriguez-459 Tudela. 2003. A point mutation in the 14alpha-sterol demethylase gene 460 cyp51A contributes to itraconazole resistance in Aspergillus fumigatus. 461 Antimicrob.Agents Chemother. 47:1120-1124. 462

14. Mellado, E., G. Garcia-Effron, M. J. Buitrago, L. Alcazar-Fuoli, M. 463 Cuenca-Estrella, and J. L. Rodriguez-Tudela. 2005. Targeted gene 464 disruption of the 14-alpha sterol demethylase (cyp51A) in Aspergillus 465 fumigatus and its role in azole drug susceptibility. Antimicrob.Agents 466 Chemother. 49:2536-2538. doi:49/6/2536 [pii];10.1128/AAC.49.6.2536-467 2538.2005 [doi]. 468

15. Pontecorvo, G., J. A. Roper, L. M. Hemmons, K. D. Mac Donald, and A. W. 469 Bufton. 1953. The genetics of Aspergillus nidulans. Adv.Genet. 5:141-470 238. 471



.org/D

ownloaded from

http://aac.asm.org/

4

16. Clinical and Laboratory Standards Institute. Reference method for broth 472 diution antifungal susceptibility Testing of Filamentous Fungi, Approved 473 Standard Second Edition. Document M38-A2. 28(16). 2008. 474

17. Clinical and Laboratory Standards Institute. Method for Antifungal Disk 475 Diffusion Susceptibility Testing of Non-Dermatophyte Filamentous Fungi. 476 Aproved Guidelines. CLSI Document M51-A. 2010. 477

478

18. Bellete, B., H. Raberin, J. Morel, P. Flori, J. Hafid, and R. T. 479 Manhsung. 2010. Acquired resistance to voriconazole and itraconazole in 480 a patient with pulmonary aspergilloma. Med.Mycol. 48:197-200. 481 doi:10.3109/13693780902717018 [doi]. 482

19. Camps, S. M., J. W. van der Linden, Y. Li, E. J. Kuijper, J. T. van 483 Dissel, P. E. Verweij, and W. J. Melchers. 2012. Rapid induction of 484 multiple resistance mechanisms in Aspergillus fumigatus during azole 485 therapy: a case study and review of the literature. Antimicrob.Agents 486 Chemother. 56:10-16. doi:AAC.05088-11 [pii];10.1128/AAC.05088-11 [doi]. 487

20. Denning, D. W., S. Park, C. Lass-Florl, M. G. Fraczek, M. Kirwan, R. 488 Gore, J. Smith, A. Bueid, C. B. Moore, P. Bowyer, and D. S. Perlin. 489 2011. High-frequency triazole resistance found In nonculturable 490 Aspergillus fumigatus from lungs of patients with chronic fungal 491 disease. Clin.Infect.Dis. 52:1123-1129. doi:cir179 492 [pii];10.1093/cid/cir179 [doi]. 493

21. Howard, S. J., I. Webster, C. B. Moore, R. E. Gardiner, S. Park, D. S. 494 Perlin, and D. W. Denning. 2006. Multi-azole resistance in Aspergillus 495 fumigatus. Int.J.Antimicrob.Agents 28:450-453. doi:S0924-8579(06)00326-8 496 [pii];10.1016/j.ijantimicag.2006.08.017 [doi]. 497

22. Howard, S. J., D. Cerar, M. J. Anderson, A. Albarrag, M. C. Fisher, A. 498 C. Pasqualotto, M. Laverdiere, M. C. Arendrup, D. S. Perlin, and D. W. 499 Denning. 2009. Frequency and evolution of Azole resistance in 500 Aspergillus fumigatus associated with treatment failure. 501 Emerg.Infect.Dis. 15:1068-1076. doi:10.3201/eid1507.090043 [doi]. 502

23. Mann, P. A., R. M. Parmegiani, S. Q. Wei, C. A. Mendrick, X. Li, D. 503 Loebenberg, B. DiDomenico, R. S. Hare, S. S. Walker, and P. M. 504 McNicholas. 2003. Mutations in Aspergillus fumigatus resulting in 505 reduced susceptibility to posaconazole appear to be restricted to a 506 single amino acid in the cytochrome P450 14alpha-demethylase. 507 Antimicrob.Agents Chemother. 47:577-581. 508

24. Mellado, E., G. Garcia-Effron, L. Alcazar-Fuoli, M. Cuenca-Estrella, and 509 J. L. Rodriguez-Tudela. 2004. Substitutions at methionine 220 in the 510 14alpha-sterol demethylase (Cyp51A) of Aspergillus fumigatus are 511 responsible for resistance in vitro to azole antifungal drugs. 512 Antimicrob.Agents Chemother. 48:2747-2750. doi:10.1128/AAC.48.7.2747-513 2750.2004 [doi];48/7/2747 [pii]. 514



.org/D

ownloaded from

http://aac.asm.org/

5

25. Mellado, E., G. Garcia-Effron, L. Alcazar-Fuoli, W. J. Melchers, P. E. 515 Verweij, M. Cuenca-Estrella, and J. L. Rodriguez-Tudela. 2007. A new 516 Aspergillus fumigatus resistance mechanism conferring in vitro cross-517 resistance to azole antifungals involves a combination of cyp51A 518 alterations. Antimicrob.Agents Chemother. 51:1897-1904. doi:AAC.01092-06 519 [pii];10.1128/AAC.01092-06 [doi]. 520

26. Verweij, P. E., E. Mellado, and W. J. Melchers. 2007. Multiple-triazole-521 resistant aspergillosis. N.Engl.J.Med. 356:1481-1483. doi:356/14/1481-a 522 [pii];10.1056/NEJMc061720 [doi]. 523

27. Pfaller, M. A. and D. J. Diekema. 2007. Epidemiology of invasive 524 candidiasis: a persistent public health problem. Clin Microbiol Rev. 525 20:133-163. 526

28. Mellado, E., T. M. Diaz-Guerra, M. Cuenca-Estrella, and J. L. Rodriguez-527 Tudela. 2001. Identification of two different 14-alpha sterol 528 demethylase-related genes (cyp51A and cyp51B) in Aspergillus fumigatus 529 and other Aspergillus species. J.Clin.Microbiol. 39:2431-2438. 530 doi:10.1128/JCM.39.7.2431-2438.2001 [doi]. 531

29. Sanglard, D., F. Ischer, L. Koymans, and J. Bille. 1998. Amino acid 532 substitutions in the cytochrome P-450 lanosterol 14alpha-demethylase 533 (CYP51A1) from azole-resistant Candida albicans clinical isolates 534 contribute to resistance to azole antifungal agents. Antimicrob.Agents 535 Chemother. 42:241-253. 536

30. Debnath, S. and S. Addya. 2014. Structural basis for heterogeneous 537 phenotype of ERG11 dependent Azole resistance in C. albicans clinical 538 isolates. Springerplus. 3:660. doi:10.1186/2193-1801-3-660 [doi];1366 539 [pii]. 540

31. Hargrove, T. Y., Z. Wawrzak, D. C. Lamb, F. P. Guengerich, and G. I. 541 Lepesheva. 2015. Structure-Functional Characterization of Cytochrome 542 P450 Sterol 14alpha-Demethylase (CYP51B) from Aspergillus fumigatus and 543 Molecular Basis for the Development of Antifungal Drugs. J.Biol.Chem. 544 290:23916-23934. doi:M115.677310 [pii];10.1074/jbc.M115.677310 [doi]. 545

32. Liu, M., N. Zheng, D. Li, H. Zheng, L. Zhang, H. Ge, and W. Liu. 2016. 546 cyp51A-based mechanism of azole resistance in Aspergillus fumigatus: 547 Illustration by a new 3D Structural Model of Aspergillus fumigatus 548 CYP51A protein. Med Mycol. 54:400-408. doi:myv102 549 [pii];10.1093/mmy/myv102 [doi]. 550

33. Oliveira, C., V, T. S. Okay, M. S. Melhem, S. M. Walderez, and G. M. del 551 Negro. 2013. The new mutation L321F in Candida albicans ERG11 gene may 552 be associated with fluconazole resistance. Rev Iberoam.Micol. 30:209-553 212. doi:S1130-1406(13)00013-2 [pii];10.1016/j.riam.2013.01.001 [doi]. 554

34. van Nistelrooy, J. G., J. M. van den Brink, J. A. van Kan, R. F. van 555 Gorcom, and M. A. de Waard. 1996. Isolation and molecular 556



.org/D

ownloaded from

http://aac.asm.org/

6

characterisation of the gene encoding eburicol 14 alpha-demethylase 557 (CYP51) from Penicillium italicum. Mol.Gen.Genet. 250:725-733. 558

35. Warrilow, A. G., J. E. Parker, D. E. Kelly, and S. L. Kelly. 2013. Azole 559 affinity of sterol 14alpha-demethylase (CYP51) enzymes from Candida 560 albicans and Homo sapiens. Antimicrob.Agents Chemother. 57:1352-1360. 561 doi:AAC.02067-12 [pii];10.1128/AAC.02067-12 [doi]. 562

563 564



.org/D

ownloaded from

http://aac.asm.org/

C973T

x

LMDM-P75

A7 A17

X CYP51A 3’UTR hph

LMDM-P82

H1 H2

HF1 A7

A17 X

A18

A19 X

H2 HF2

hph

pUM102

H1

A7

LMDM-P87

H2

CYP51A 3’UTR hph X

Figure 1



.org/D

ownloaded from

http://aac.asm.org/

Figure 2

200 bp

X A10 A7

1066 bp

A14

Wild type akuBKU80

A10 A7

1066 bp

A14

HS4 HS3

386 bp

HS4 HS3

2.4 kb

LMDM-32

X A10 A7

1066 bp

A14

HS4 HS3

386 bp

HS4 HS3

3.5 kb

LMDM-1030

X A10 A7

1066 bp

HS4 HS3

386 bp

HS4 HS3

LMDM-P87

A10 HS4 HS3

386 bp

pUM-102

A



.org/D

ownloaded from

http://aac.asm.org/

1 2 3 4 5 M 6 7 8 9 10 B

Wild type akuBKU80 LMDM-1030 C



.org/D

ownloaded from

http://aac.asm.org/

M 1 2 3 4



.org/D

ownloaded from

http://aac.asm.org/

A. fumigatus

akuBKU80

LMDM-1030

(I301T Cyp51Ap)

LMDM-32 (CYP51AΔ)

FLC – disks

VRC – disks

FLC – e-test



.org/D

ownloaded from

http://aac.asm.org/

downloaded from //s3-eu-west-1.amazonaws.com/awarticles/27381395.pdf · 162 (tecnolab-ab, buenos...

Documents