acidos nucleicos

36
ACIDOS NUCLEICOS QBP Karina Astorga Talamantes

Upload: miyo940

Post on 26-Jul-2015

405 views

Category:

Education


2 download

TRANSCRIPT

Page 1: Acidos nucleicos

ACIDOS NUCLEICOS

QBP Karina Astorga Talamantes

Page 2: Acidos nucleicos

La estructura de la enorme variedad de proteínas que se encuentran en los

organismos está codificada en moléculas conocidas como ácidos nucléicos.

La información contenida en los ácidos nucléicos es transcrita y luego traducida a

las proteínas.

Los ácidos nucléicos están formados por cadenas largas de nucleótidos.

QBP Karina Astorga Talamantes

Page 3: Acidos nucleicos

Son polímeros constituidos por la unión mediante

enlaces químicos de unidades menores llamadas

nucleótidos

Son compuestos de elevado peso molecular

, es decir macromoléculas

Ácidos Nucléicos

QBP Karina Astorga Talamantes

Page 4: Acidos nucleicos

Nucleósidos

Son las moléculas resultantes de la unión de una base nitrogenada y un azúcar

(pentosa); mediante enlace N-glucosídico que se establece entre el C1´ de la pentosa y

un nitrógeno de la base (el N1 si es pirimidínica y el N9 si es púrica) con la pérdida de

una molécula de agua.

Se nombran añadiendo al nombre de la base la

terminación:

–osina si es una base púrica

–idina si se trata de una base pirimidínica,

Si la pentosa es la desoxirribosa, se añade el

prefijo desoxi-

ejemplo, desoxiadenosina o desoxicitidina.

QBP Karina Astorga Talamantes

Page 5: Acidos nucleicos

Nucleótidos

Están formados por:

Una base nitrogenada BN

Un azúcar (pentosa) A

Ácido fosfórico (H3PO4) P

Los nucleótidos son los ésteres fosfóricos de los nucleósidos.

QBP Karina Astorga Talamantes

Page 6: Acidos nucleicos

La pentosa puede ser:

Ribosa

Desoxirribosa

QBP Karina Astorga Talamantes

Page 7: Acidos nucleicos

La base nitrogenada puede ser:

PURINAS

Adenina A

Guanina G

PIRIMIDINAS

Citosina C

Timina T

Uracilo U

QBP Karina Astorga Talamantes

Page 8: Acidos nucleicos

BASES NITROGENADAS DERIVADAS DE LA PURINA

(DNA/RNA)

(DNA/RNA)

QBP Karina Astorga Talamantes

Page 9: Acidos nucleicos

BASES NITROGENADAS DERIVADAS DE LA PIRIMIDINA

(DNA)

(RNA)

(DNA/RNA)

QBP Karina Astorga Talamantes

Page 10: Acidos nucleicos

FUNCIONES DE LOS NUCLEÓTIDOS

Son fundamentales para la vida de las células, pues al unirse con otras

moléculas cumplen tres funciones cruciales:

TRANSPORTAN ENERGÍA

TRANSPORTAN ÁTOMOS

TRANSMITEN LOS CARACTERES HEREDITARIOS

QBP Karina Astorga Talamantes

Page 11: Acidos nucleicos

PROPIEDADES FÍSICO-QUÍMICAS DE LAS BASES NITROGENADAS

1. Naturaleza básica

2. Hidrofobicidad y disposición coplanar

3. Dipolos

4. Tautomería

5. Absorción de luz

QBP Karina Astorga Talamantes

Page 12: Acidos nucleicos

guanina

timina

uracilo

http://av.bmbq.uma.es/av_biomo/FigT8/tema8.pdf QBP Karina Astorga Talamantes

Page 13: Acidos nucleicos

TRANSPORTAN ENERGÍA

•Cada nucleótido puede contener

•uno (monofosfato: AMP),

•dos (difosfato:ADP) o

• tres (trifosfato: ATP) grupos de acido fosfórico

Los nucleótidos, por razón de sus grupos de fosfato, son fuentes preferidas en

las células para la transferencia de energía. Los nucleótidos se encuentran

en un estado estable cuando poseen un solo grupo de acido fosfórico.

Cada grupo de fosfato adicional que posea un nucleótido se encuentra en un

estado más inestable y el enlace del fosfato tiende a romperse por hidrólisis y

liberar la energía que lo une al nucleótido.

QBP Karina Astorga Talamantes

Page 14: Acidos nucleicos

TRANSPORTE DE ÁTOMOS O MOLÉCULAS

En algunas reacciones metabólicas un grupo de átomos

se separa de un compuesto y es transportado a otro

compuesto.

Dicho grupo de átomos se une temporariamente a una

coenzima

(molécula transportadora de sustancias)

Muchas vitaminas tienen esta función

QBP Karina Astorga Talamantes

Page 15: Acidos nucleicos

•vitamina B1o tiamina

•vitamina B2 o riboflavina: sus derivados son nucleótidos enzimáticos el

[FAD+](Flavin-adenín dinucleótido)o el [FMN+] (Flavín mononucleótido)

•vitamina B3 o niacina: sus derivados son nucleótidos enzimáticos con gran

poder reductor como el [NAD+](Nicotin-adenín dinucleótido)o el [NADP+] (Nicotin-

adenín dinucleótido fosfato)

•vitamina B5 o ácido pantoténico: su principal derivado es la coenzima A

(CoA) con gran importancia en procesos metabólicos.

•vitamina B6o piridoxina

•vitamina B12o covalamina

QBP Karina Astorga Talamantes

Page 16: Acidos nucleicos

TRANSMITIR CARACTERES HEREDITARIOS

Para cumplir esta función, los nucléotidos se

polimerizan formando polinucleótidos en

forma de cadena, llamados ácidos nucléicos.

QBP Karina Astorga Talamantes

Page 17: Acidos nucleicos

Un enlace fosfodiéster es un tipo de enlace covalente que se

produce entre un grupo hidroxilo (OH-) en el C3' y un grupo

fosfato (PO43− ) en el C5' del nucleótido entrante, formándose así

un doble enlace éster.

Los enlaces fosfodiéster son esenciales para la vida, pues son los

responsables del esqueleto de las hebras de ADN y ARN.

ENLACE FOSFODIÉSTER

QBP Karina Astorga Talamantes

Page 18: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 19: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 20: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 21: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 22: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 23: Acidos nucleicos

Se pueden distinguir 3 niveles estructurales:

-Estructura primaria: La secuencia de los nucleótidos.

-Estructura secundaria: La doble hélice.

-Estructura terciaria: Collar de perlas, estructura cristalina,

ADN superenrollado.

QBP Karina Astorga Talamantes

Page 24: Acidos nucleicos

ESTRUCTURA PRIMARIA

Es la secuencia de nucleótidos de una cadena o hebra.

Es decir, la estructura primaria del ADN viene determinada por el

orden de los nucleótidos en la hebra o cadena de la molécula. Para

indicar la secuencia de una cadena de ADN es suficiente con los

nombres de las bases o su inicial (A, T, C, G) en su orden correcto y

los extremos 5' y 3' de la cadena nucleotídica.

Ejemplo:

5'ACGTTTAACGACAAGGACAAGTATTAA3'

QBP Karina Astorga Talamantes

Page 25: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 26: Acidos nucleicos

WATSON y CRICK postularon en 1953 un modelo

tridimensional para la estructura del ADN: el modelo

de doble hélice.

QBP Karina Astorga Talamantes

Page 27: Acidos nucleicos

Según el modelo de la doble hélice de WATSON y CRICK:

1. El ADN estaría constituido por dos cadenas o hebras de polinucleótidos enrolladas

helicoidalmente en sentido dextrógiro sobre un mismo eje formando una doble hélice.

2. Ambas cadenas serían antiparalelas, una iría en sentido 3’5' y la otra en sentido

inverso, 5' 3'.

3. Los grupos fosfato estarían hacia el exterior dando más estabilidad a la molécula.

4. Las bases nitrogenadas estarían hacia el interior de la hélice con sus planos paralelos entre

sí y las bases de cada una de las hélices estarían apareadas con las de la otra asociándose

mediante puentes de hidrógeno.

5. El apareamiento se realizaría únicamente entre la adenina y la timina, por una parte, y la

guanina y la citosina, por la otra.

Por lo tanto, la estructura primaria de una cadena estaría determinada por la de la otra, ambas

cadenas serían complementarias.

QBP Karina Astorga Talamantes

Page 28: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 29: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 30: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 31: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 32: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 33: Acidos nucleicos

QBP Karina Astorga Talamantes

Page 34: Acidos nucleicos

Representa la forma superenrollada de la estructura secundaria.

Es la forma en la que se encuentra generalmente el DNA en el interior de la célula

ESTRUCTURA TERCIARIA DEL ADN

QBP Karina Astorga Talamantes

Page 35: Acidos nucleicos

FUNCIONES DE LOS ÁCIDOS NUCLEICOS

Síntesis de proteínas específicas de la célula

Almacenamiento, replicación y transmisión de la información

genética

La función principal del ARN es servir como intermediario de la

información que lleva el ADN en forma de genes y la proteína final

codificada por esos genes.

QBP Karina Astorga Talamantes

Page 36: Acidos nucleicos

QBP Karina Astorga Talamantes