facultad de farmacia - dadun: página de...
TRANSCRIPT
FACULTAD DE FARMACIA
EFECTOS DEL ÁCIDO LIPOICO SOBRE LA FUNCIÓN
MITOCONDRIAL Y EL ESTRÉS OXIDATIVO EN LA ENFERMEDAD
HEPÁTICA NO ALCOHÓLICA ASOCIADA A OBESIDAD
EFFECTS OF LIPOIC ACID ON MITOCHONDRIAL FUNCTION AND
OXIDATIVE STRESS IN THE NON‐ALCOHOLIC FATTY LIVER
DISEASE LINKED TO OBESITY
Mª Pilar Valdecantos Jimenez de Andrade
Pamplona, 2012
FACULTAD DE FARMACIA
Memoria presentada por Dña. MªPilar Valdecantos Jimenez de Andrade para aspirar al
grado de Doctor en Farmacia
Fdo. Mª Pilar Valdecantos Jimenez de Andrade
El presente trabajo ha sido realizado bajo nuestra dirección en el Departamento de
Ciencias de la Alimentación, Fisiología y Toxicología y autorizamos su presentación
ante el Tribunal que lo ha de juzgar.
Vo Bo Director Vo Bo Co‐directora
Dr. J. Alfredo Martínez Hernández Dra. Carmen Patricia Pérez Matute
Este trabajo ha sido posible gracias a la financiación de diversas entidades: Asociación de
Amigos de la Universidad de Navarra (beca predoctoral 2007‐2008), Instituto de Salud Carlos III
(Beca predoctoral de investigación en salud 2008‐2012), RETICs y CIBERobn. Proyecto
Nutrición, Obesidad y Salud “Línea Especial” Universidad de Navarra LE/97, Ministerio de
Educación y Ciencia (AGL2006‐04716/ALI) y Ministerio de Ciencia e Innovación (AGL 2009‐
10873/ALI).
"La ciencia es un magnífico mobiliario para el piso
superior de un hombre, siempre y cuando su
sentido común esté en la planta baja"
Oliver W. Holmes
“Para los científicos Dios está el final de todas sus
reflexiones"
Max Planck
"El trabajo endulza siempre la vida, pero los
dulces no le gustan a todo el mundo”
Victor Hugo
A mis padres
Agradecimientos
Decía Goethe que “es muy común recordar que alguien nos debe agradecimiento, pero es
más común no pensar en quienes les debemos nuestra propia gratitud", espero no caer en
este error y conseguir acordarme de todos aquellos a los que debo agradecimiento. Si, por
despiste o inconsciencia, alguno no se encuentra en estas líneas no dude que en algún
momento durante estos años pensé en que esos quería consignar su contribución en estas
breves palabras.
En primer lugar, me gustaría agradecer a la Universidad de Navarra y a la Facultad de
Farmacia el haberme formado tanto profesional como personalmente. También quisiera
agradecer al Departamento de Ciencias de la Alimentación, Fisiología y Toxicología la
oportunidad de desarrollar el presente trabajo de investigación e iniciar mi camino en la
carrera investigadora y docente.
Además, quisiera reconocer especialmente a la Asociación de Amigos de la Universidad de
Navarra no sólo la beca recibida en el inicio de esta andadura sino todos los sacrificios que
realizan para que muchos desarrollemos nuestra investigación. Quizás, en el día a día no
seamos conscientes de la magnanimidad y el sacrificio con que muchas personas sacan
adelante cada euro para hacer posibles estos proyectos, pero no quiero pasar un día tan
señalado sin tener presentes a tantas personas anonimas. Gracias también al Instituto de
Salud Carlos III por la beca concedida durante estos años y por darme la posibilidad de
colaborar con otros grupos de investigación.
Especial gratitud le debo al Dr. Alfredo Martínez por todos sus consejos y orientaciones
científicas y personales y ser tan genial como para definir un esbozo de esta tesis en
nuestras conversaciones en el Metro de Madrid y por ayudarme a enfrentarme a los
diferentes “Sanchos” por los que he pasado a lo largo de estos años. No querría dejar de
reconocer su esfuerzo por mantener recto el timón de este barco que es la Línea Especial y
lo que no es menos importante conseguir las “provisiones” necesarias para la navegación
de todos nosotros por estos mares de la Ciencia. Decía Cicerón que “una cosa es saber y
otra saber enseñar” quería ahora agradecerle a la Dra. Patricia Pérez‐Matute no sólo el
haber contribuido con sus conocimientos y consejos a este trabajo, sino el haber sabido
enseñarme con su dedicación y ejemplo cómo enseñar a otros. En resumen, gracias a
ambos por vuestros consejos, vuestra dedicación y esfuerzo. Gracias por la confianza
depositada en mí y por haberme transmitido ese gran interés no sólo por la investigación
sino también por la docencia.
Agradecimientos
During my staying in the Department of Human Biology, in Maastricht, I will never forget
Professor Patrick Schrauwen, thank you very much for the opportunity to stay in your
laboratory and for all your interest in my research. Thank you very much to Sabina
Paglialunga; thanks for your interest and expert supervision. “Heel erg bedankt” to all the
people in the lab for being so friendly and patient and thanks as well for all your help in
many ways.
Querría agradecer también a la Dra. Martínez Valverde la posibilidad de trabajar en su
laboratorio durante los últimos meses de este trabajo de investigación. Como no recordar
en este punto a Agueda, Beatriz, Virginia, Maysa, Lucia y Ana, ellas han hecho que desde el
primer día me sintiera como en casa, estando siempre dispuestas a enseñarme y guiarme.
Espero que este sea sólo el comienzo de una colaboración agradable y productiva.
También agradezco a la Dra. López Zabalza su inestimable apoyo científico, sobre todo en el
inicio de esté trabajo y su interés por mis progresos a lo largo de estos años. Como no
nombrar aquí al Dr. Aguirre que desde que estuvo en mi tribunal del DEA ha estado siempre
disponible para solucionar mis dudas y aconsejarme con su amplia experiencia, espero
sinceramente que su nuevo trabajo este tan lleno de éxitos como el anterior. Reconocer al
Dr. Rial su paciencia y consejos durante el primer año de mi tesis así como su dedicación
para explicarme lo necesario acerca del consumo de oxígeno y sus misterios. Especial
agradecimiento merece la Dra. Iciar Velaz, he dudado si incluirte entre los profesores o los
amigos, porque durante los últimos años para mi has sido una auténtica maestra y amiga,
gracias por tus consejos y tu escucha desinteresada y por poner siempre un punto de
humor en nuestras conversaciones.
Gracias a todo el vecindario del edificio de Investigación. En el fondo con quien más y quien
menos nos hemos cruzado alguna vez en el torno o en las escaleras y hemos compartido
muchas mañanas de lunes. Especialmente en deuda me encuentro con mi “departamento
adoptivo”, nuestras vecinas de Bioquímica a pesar de que cada año nos “humilléis” con
vuestros “superbelenes” en el fondo no os lo tenemos en cuenta y esperamos vuestra
creatividad. Silvia y Mª José, gracias por invitarme a café de vuestra maravillosa cafetera y
sobre todo por escucharme tantas veces; Marina, Antonia y María ¡que hubiera hecho yo
sin vosotras ante mis crisis con el Western!. Cómo no nombrar en este punto a los “vecinos
de abajo”, gracias a todo el departamento de Farmacología especialmente a Elena y Maite
por encontrarme su sonrisa y comprensión los viernes a las 9, especialmente gracias a Elena
Agradecimientos
por ayudarme con su sabiduría “Starkov”. También recordar especialmente a Lourdes y
Lucia por acompañarme en el cuarto oscuro y ver bandas donde no las hay. Gracias a mis
“compañeros de inglés” Iosu, Javier y Marina, por hacer más fáciles las clases a las 2.30 y
ayudarme con consejos varios. Por último, un especial recuerdo a Elisa mi maestra con las
LDAs, gracias por tu ayuda y por alegrarme las mañanas con tu amplía sonrisa.
No quiero avanzar más sin reconocer el trabajo de tantas “personas invisibles” que han
hecho posible esta y otras muchas tesis. En primer lugar, gracias a Reyes Saénz y a Gonzalo
Flandes por recibirnos con una sonrisa y estar siempre dispuestos a contestar mis dudas
aunque este claramente explicado en las instrucciones. Gracias al personal de limpieza y
mantenimiento ‐ los auténticos invisibles‐ y perdón por cuantas veces haya podido
dificultar su trabajo. Como no recordar aquí a los bedeles, los “hombres de gris” siempre
dispuestos a darte una llave o abrirte el torno cuando por enésima vez se te ha olvidado el
carné esa semana. Especialmente, quiero agradecer la sonrisa diaria y las bromas al final del
día a Gonzalo, Jesús y Enrique. Por último, un recuerdo especial a la gente de la biblioteca
por facilitarnos nuestro trabajo especialmente a Arantxa, Lucia y Rocío por explicarme
hasta la saciedad y resolver todas mis dudas acerca de sabio, refworks, dadun etc.
Si algo he aprendido durante estos años es que la investigación es fundamentalmente
colaboración, dicho con palabras de la Madre Teresa de Calcuta he experimentado en
numerosas ocasiones que “yo hago lo que usted no puede, y usted hace lo que yo no
puedo. Juntos podemos hacer grandes cosas”. Por eso quería agradecer a todos esos
“ustedes” que han hecho posibles grandes cosas durante estos años. En especial al Dr.
Fermín Milagro y al Dr. Javier Campión sus sabios consejos y, sobre todo, su comprensión y
su alegría para escucharme y responderme siempre todas las dudas, gracias por ese primer
año en el 215 en el que con vuestro ejemplo aprendí más que con muchas lecciones.
A todos quienes forman el departamento de Ciencias de la Alimentación, Fisiología y
Toxicología el haberse preocupado por mí durante todos estos años; a la Dra. Mª Jesús
Moreno‐Aliaga quiero agradecerle sus continuas muestras de interés en la evolución de mis
investigaciones. A la Dra. Ana Barber, gracias por su confianza y sobre todo, su alegría. A la
Dra. Marian Zulet muchas gracias por tu apoyo en nuestra labor docente y por ser siempre
nuestra “fan” número uno, por apoyarnos en nuestro problemas y darnos ánimo cuando lo
necesitabamos. A las Dras. Pilar Lostao, Amelia Martí, Iciar Astiasarán, Diana Ansorena,
Agradecimientos
Conchita Cid y Mª Paz de Peña les transmito mi gratitud por sus continuas muestras de
ánimo e interés. Gracias a todos por vuestra cercanía.
Especialmente quiero agradecer a la Dra. Adela López de Ceraín su dedicación y consejos,
gracias por escucharme siempre que ha sido necesario y por tener en cuenta mis puntos de
vista, por no decir nunca un “no tienes razón”, aunque supongo que lo merecería en algún
momento. Y sobre todo, por interesarse siempre por la evolución de esta tesis y por su
apoyo incondicional en todo momento.
A Pedro González Muniesa, sinceramente no sé qué poner en estas líneas porque todo
parece poco y se queda pobre. Gracias por estar siempre ahí. Primero como una “presencia
invisible”, la de “mi predecesor mitocondrial”, no sé si lo sabes pero me sé de memoria el
material y métodos de tu tesis. Después, a tu regreso de Liverpool, has sabido escuchar,
aconsejar y aportar desde la sombra y sin buscar nada a cambio, has estado siempre
disponible incluso quitándote horas de sueño y creándome por ello cierto cargo de
conciencia. Sólo decirte que esta tesis no hubiera sido posible sin tu apoyo, aunque espero
que ya lo sepas, MUCHAS GRACIAS.
A Ana Lorente, qué decirle a mi mayor maestra del laboratorio, gracias por tu enorme
paciencia, en ocasiones rayana al infinito, por enseñarme a trabajar, por estar siempre ahí
para pedidos, partes y dudas, pero sobre todo por haber aguantado estoicamente al
consumo de oxígeno con su “carácter temperamental”. A Vero, por haber estado dispuesta
siempre a todo lo que he necesitado y por tu pericia con el Cobas al que conoces mejor que
nadie. A Asun gracias por tu buen humor en todo momento y por descubrirme las
maravillas de Navarra.
A Paula y Beatriz, muchísimas gracias por vuestra disponibilidad siempre que he necesitado
algo, desde un dato para una de mis innumerables solicitudes de becas o un cuaderno
nuevo, en definitiva, por brindarme vuestra sonrisa cuando bajaba a visitaros y saber que
cuando os decía que erais lo mejor del departamento no iba, ni mucho menos, en broma.
Llega el momento de agradecer a todos los que pasaron por el departamento y ahora están
dispersos por tierras españolas y extranjeras, todos ellos me indicaron con su ejemplo el
camino a seguir, han sido como las luces en un camino de montaña mostrando el siguiente
paso pero sin iluminarlo todo para no asustarme de los peligros venideros. Quería recordar
especialmente a Silvia, por desgracia no estás aquí para ver este momento pero sé que
Agradecimientos
desde Estocolmo sigues todos mis avances y retrocesos, gracias por tu amistad y tu ejemplo
me has enseñado más de lo que crees. Gracias especiales a Diego, nuestro asesor
informático número uno siempre dispuesto a limpiar el ordenador, instalar la wifi etc y,
sobre todo, gracias por enseñarme con tu ejemplo a sacar una tesis sin perder de vista que
es lo realmente importante en la vida. A Cristina, por su ejemplo. Gracias a mi “Fairy”
(Nerea) por ser siempre tan alegre y saber “desengrasar” tantos momentos difíciles con tu
sonrisa. A mis maestras de prácticas, Esti, Blanca e Itzi por vuestra paciencia y entrega en la
labor docente no solo con los alumnos sino con los novatos. Itzi, gracias por tu compañía en
esos meses holandeses en especial por vivir conmigo la victoria del Mundial en “territorio
comanche” y evitar que me lincharan. Gracias también a AnaBe por su tranquilidad y
buenos consejos, su sonrisa permanente y por la acogida que nos disteis en Santiago. Almu,
gracias por estar ahí y ahora por continuar desde secretaria apoyando a tus compañeras.
Helen, mi media naranja en prácticas, muchísimas gracias por haberme enseñado tanto y
por haber sabido aprovechar mis ideas peregrinas y ponerlas juntas en prácticas, gracias
por haberme enseñado tanto de ese “querido pueblo brasileño”. Y como no a André gracias
por tu buen humor constante y que San Isidro cultivador te proteja.
A los nuevos agradeceros vuestra ilusión porque a veces cuando llevas tiempo en el camino
se nos olvida lo maravilloso de esta profesión y con vuestro entusiasmo diario nos lo
trasmitís. Uxune, te dije que con tu interés en estos meses de biblioteca te habías ganado
una frase en estos agradecimiento, ahora fuera de broma muchísimas gracias porque
durante estas semanas cada mañana te encontraba al “otro lado del muro” sonriendo y
dispuesta a escuchar. A Miki “el vikingo” por todo lo que me has enseñado con tu serenidad
y tesón durante el máster, sigue así y llegarás muy lejos. A Idoia, ánimo con las prácticas
seguro que te ganas a todos los alumnos.
Bueno ahora les llega el momento a todos con los que durante estos años he compartido
este viaje en el que todos y cada uno habéis estado a mi lado. A Laura y Adri, juntas
empezamos en este camino, ¿Quien nos iba a decir que este día llegaría? Pero aquí
estamos y ahora se nos abre una nueva etapa. Estoy segura que será difícil encontrar tan
buenas compañeras de camino. A Beich, gracias por tu bondad y constancia en el trabajo,
por superarte en cada momento y sobre todo por tu cariño y amistad. A Noe y a Pablo,
gracias por enseñarme con vuestro ejemplo el sentido de la lealtad y el compañerismo
verdadero. A Tara por trasmitirme cada lunes el espíritu rojillo de ahora en adelante
Agradecimientos
siempre que vea la tabla de clasificación miraré si ese año le toca sufrir a Osasuna. A Ceci,
gracias por tu sonrisa perenne en el café y por haberme enseñado lo que se puede hacer
con cariño y maña. Rocío, gracias por compartir tantas idas y venidas a Madrid y sus
conversaciones correspondientes. A Aurora y Patricia por ser las mejores compañeras de
prácticas y a Ana Laura por dulcificarnos con su suavidad y por hacer el mejor guacamole
del mundo. A Pedro, muchas gracias por tu apoyo durante estos años en los que con sus
más y sus menos hemos surcado este camino. Marta, gracias por el “lipoic team”. A ambos,
gracias por todo los momentos compartidos durante estos años y por haber formado parte
de vuestro equipo. Casi se me olvidan mis compañeros del piso de abajo, a Carmen por tu
alegría constante, a Carlos porque aunque nos quejemos de lo que hablas en el fondo sin
tus conversaciones los cafés no serian lo mismo, a Jonai ánimo espero que todo te vaya
bien porque te lo mereces.
Me toca ahora afrontar la ardua tarea de responder a todo el cariño recibido por mis
amigos durante estos años, ardua porque lo que está en mi corazón no puede recogerse en
estas líneas, ni en libros enteros que escribiera. No sé qué deciros y todo lo que callo es lo
auténticamente importante, en algún sitio leí que un amigo es alguien con quien se puede
estar en silencio y, aunque os parezca increíble, me he quedado sin palabras, aprovechar
que no volverá a pasar. Sólo agradeceros el haber formado parte de mi vida y sobre todo el
haberme dejado formar parte de las vuestras y espero que de ahora en adelante siempre
sigamos unidos a pesar de los vaivenes de la vida. Lo que a continuación escribo sólo
espero que haga aflorar a vuestros labios una sonrisa como la que está en los míos mientras
escribo. A Anica, mi fiel compañera de prácticas, compras, mesa… gracias por aguantar mis
invasiones de territorio, escuchar mis bromas y anécdotas en prácticas mil veces como si
fuera la primera, por ser la mejor co‐responsable que cualquiera pueda soñar y por
supuesto por haberme descubierto el maravilloso mundo de Sephora y demás trucos de
maquillaje. Gracias por tu amistad y por ser como eres, un espíritu único que rompe
moldes. A Paúl, el mejor guía turístico de la noble villa de Portugalete, eres la mejor agenda
electrónica humana que existe y el corrector infalible, como amigo no tienes precio,
aunque espero que con tus futuros doctorandos no seas tan exigente. A Barrankas (¿o eras
Trankas?) vamos a María gracias por haberme sorprendido día tras día con tu categoría
humana, tu gran corazón y tu sonrisa permanente, nunca sabrás todo lo que me has
enseñado y espero que me sigas enseñando a lo largo de los años. A David, muchísimas
gracias por ponernos los pies en el suelo a este grupo de científicos frikis fuiste el último en
Agradecimientos
entrar en el grupo pero por una adquisición así vale la pena esperar. A Teresa mi
“bioquímica favorita” gracias por tus sabios consejos pero sobre todo gracias por haber
podido formar parte de tantos acontecimientos importantes en tu vida y por no tener
nunca necesidad de “explicarme”. Al artista de nuestro grupo, Toni, por poner el punto de
belleza en nuestras cabezas científicas y por descubrirme tantos rincones de Pamplona y,
ante todo, por haberme permitido formar parte de esa nueva familia. A Marta, ya sabes
que nuestros caminos siempre se juntan, después de nuestros años madrileños vinieron los
pamplonicas, quien sabe cuál será el próximo destino que nos depare la vida pero lo que sí
que es seguro es que, nos crucemos o no, siempre serás para mí un ejemplo a seguir,
gracias por tu cariño y comprensión durante esta década.
También, me gustaría recordar a Emi, mi compañera en tierras holandesas. Al comienzo de
esos meses dijimos que al final o nos odiábamos o seríamos amigas de por vida, parece que
ha ocurrido los segundo. Gracias por estar ahí durante esos meses, por escucharme y
compartir el lunch cada día, por los kilómetros recorridos, por socorrerme con mis crisis
lingüísticas y por tantas otras cosas que las dos recordaremos el resto de nuestras vidas.
A toda la gente que fuera del ámbito de la Universidad me ha apoyado durante estos años.
A mi amiga Valle, que desde Asturias primero y en Barcelona después siempre me ha
apoyado con la voz de su experiencia, por todo el cariño brindado a lo largo de tantos años.
A mis amigas de toda la vida, Izaskun, Paloma, Elena, Dena etc por haber sabido estar a mi
lado siempre que os he necesitado desde hace tantos años que prefiero no ponerlos aquí,
siempre habéis estado ahí y sé que siempre lo estaréis.
Especialmente, quería agradecer a todas las de mi casa su apoyo incondicional en
momentos que no siempre han sido fáciles, gracias por haberme escuchado mis
conversaciones científicas con una sonrisa en los labios y por compartir mis logros y caídas,
en definitiva gracias por quererme por quién soy y no por cómo soy. No quería pasar estas
líneas sin agradecer a Marga y a Sonsoles su apoyo constante en estos años. No sé cómo
expresar lo que todas vosotras me habéis ayudado, porque es probable que ni siquiera yo
lo sepa del todo, en algún momento seré consciente pero por si entonces no os tengo al
lado no quiero perder la oportunidad de daros las gracias ahora.
A toda mi familia por su apoyo constante, gracias a mis tíos y mis primos que han seguido
mi evolución cada vez que nos encontrábamos en cualquier evento familiar. Especialmente
Agradecimientos
gracias a mi tío Javier, por haberme mostrado con su ejemplo la importancia y grandeza del
profesor universitario. A tío Pablo, porque con su trabajo incansable me ha enseñado los
valores de un buen trabajador y por sentirse orgulloso de su “sobrina la investigadora”. A
mi primo Pablo, quién nos iba a decir en aquellos trayectos de tren a las 8 de la mañana que
defenderíamos la tesis el mismo año, pues ya ves aquí estamos aunque como siempre tú
me hayas adelantado. A Pastora, por proteger siempre a tu prima favorita por tu cariño y tu
comprensión y por tus visitas anuales a Pamplona. A Las TíAS con mayúscula, gracias por
vuestros desvelos y por vuestro cariño, por estar ahí siempre, por ser el baluarte sobre el
que apoyarnos porque en medio de las tormentas sois un refugio seguro y por ser lo más
parecido a una madre para mí en los últimos diez años, nunca sabré que habría sido nuestra
vida sin vosotras.
A mis hermanos y mis cuñadas, ya veis la benjamina de la familia va defender la tesis y
todos os preguntaréis, ¿cómo se le ocurre a un Valdecantos investigar sobre la obesidad? y
sin duda Antonio pensará “y yo que pensaba que era tonta”, ya veis ironías de la vida y
Antonio que el empaque de este acto no te ciegue en el fondo sigo siendo la de siempre.
Bromas aparte, he intentado redactar estas líneas muchas veces en estos años, cada vez
que regresaba de Madrid las pensaba mentalmente y cuando el tren se adentraba en las
llanuras castellanas sólo podía dar gracias a Dios por la familia que me ha concedido porque
soy la más afortunada de las personas. Como sabéis en nuestra familia no somos dados a
los sentimentalismos, más bien a la ironía madrileña, por eso quizá me cueste expresar lo
que mi corazón desearía en estas líneas, pero ¿cómo puede expresar un brote joven su
agradecimiento a los árboles robustos que le han protegido siempre con su presencia?
Vosotros sois esos árboles y yo no encuentro más palabras para daros las gracias que esta,
GRACIAS. Quería dar las gracias a mis sobrinos, la mayoría no son conscientes de que hago
tan lejos y probablemente no se den cuenta lo reconfortantes que son sus risas infantiles y
su cariño pero durante estos años, en los momentos difíciles, mirar sus caras sonrientes y
traviesas en mi fondo de pantalla me ha arrancado más de una sonrisa y me ha devuelto las
ganas de seguir trabajando con ilusión.
Llega ahora el momento de agradecer a mis padres no esta tesis sino la vida pero, gracias a
Dios, juego con ventaja porque desde el cielo me acompañan, me guian y no necesito de
palabras para que lean en mi corazón. Ellos son lo mejor que ha ocurrido en mi vida, nunca
sabré lo que hicieron por mi y tan solo lo poco que intuyo me abruma. Durante muchos
Agradecimientos
años una obsesión a ocupado mi corazón ¡hazte digna de sus sacrificios!, pero al final me he
dado cuenta que nunca lo seré y, a la vez, que lo soy siempre porque para ellos lo
importante nunca fue que fuera la mejor en nada solamente que fuera yo y les diera el
poco amor que mi corazón de hija podía. Ellos son mi ejemplo en todo lo que hago, son los
rodrigones que han marcado mi crecimiento, han sido y siempre serán mi apoyo. Muchos
pensarán que en este día tan señalado echare en falta su presencia y, aunque en parte
tengan razón, en el fondo ellos están más presentes, hoy y siempre, desde el cielo que
todos los demás.
Por último, quería mostrar mi agradecimiento a Dios por haberme dado todo cuanto soy y
poseo, por regalarme la mejor familia del mundo y poner a mi lado a amigos que con su
cariño me han protegido y querido. Por darme las oportunidades necesarias para llegar a
este punto del camino y por cuidarme cada día y seguir haciéndolo siempre.
Abreviaturas
25
18s 18S rRNA eucariotico
Eukaryotic 18S rRNA
Acadl Acetil coenzima A deshidrogenasa, ácidos grasos de cadena larga
Acyl‐Coenzyme A dehydrogenase, long‐chain
AcCoA Acetil coenzima A
Acetyl coenzyme A
Acox1 Acil‐Coenzima A oxidasa 1, palmitoil
Acyl‐Coenzyme A oxidase 1, palmitoyl
Actb β‐Actina
β‐Actin
ADHA Ácido dehidroascórbico
Deydroascorbic acid
AESAN Agencia Española de Seguridad Alimentaria y Nutrición
Spanish Agency for Food Safety and Nutrition
AL/LA Ácido α lipoico
α‐lipoic acid
ALT Alanina aminotransferasa
Alanine aminotransferase
AMP Adenosin di‐fosfato
Adenosine diphosphate
AMPK Quinasas activadas por AMP
AMP‐activated proteína kinase
ARE Elementos de respuesta a antioxidantes
Antioxidant response elements
AST Aspartato aminotransferasa
Aspartate aminotransferase
ATP Adenosin tri‐fosfato
Adenosine triphosphate
Atp5c1 Complejo ATP sintasa mitocondrial F1 γ polipept. 1
ATPsynthase, H+transporting, mitochondrial F1 complex, γ polypeptide1
BSA Albumina sérica bovina
Bovine serum albumin
Abreviaturas
26
Cat Catalasa
Catalase
CEEA Comité de ética para experimentación animal
Ethics committee for animal experimentation
CIFA Centro de Investigación en Farmacobiología Aplicada
Centre of Applied Pharmacobiology
Cit C Citocromo C
Cytochrome C
CK Ciclo de Krebs
Krebs cycle
CoQ Coenzima Q
Coenzime Q
COX I Citocromo c oxidasa, subunidad I
Cytochrome C oxidase, subunit I
COX II/Mtco2 Citocromo c oxidasa, subunidad II
Cytochrome c oxidase subunit II
COX III Citocromo c oxidasa, subunidad III
Cytochrome c oxidase subunit III
Cpt1 Carnitin palmitoil transferasa 1
Carnitine palmitoil transferase 1
Crebp Proteína de unión al elemento de respuesta a cAMP
cAMP‐response element‐binding protein
CS Citrato sintasa
Citrate synthase
CTE/ETC Cadena de transporte de electrones
Electron transport chain
DCPIP 2,6‐diclorofenolindofenol
2,6‐dichlorophenolindophenol
Dgat2 Diacilglicerol acil transferasa 2
Diacylglycerol O‐acyltransferase homolog 2
DHLA Ácido dihidrolipoico
Dihidrolipoic acid
Abreviaturas
27
DMT2 Diabetes Mellitus tipo 2
Type 2 Diabetes
DTNB Ácido 5,5’‐dithiobis‐2‐nitrobenzoico
5,5‐dithiobis (2‐nitrobenzoic acid)
ECV Enfermedad cardiovascular
Cardiovascular disease
ELISA Ensayo por inmunoabsorción ligado a enzimas
Enzyme‐Linked ImmunoSorbent Assay
eNOS Oxido nítrico sintasa endotelial
Endothelial Nitric Oxide synthase
ERK Señal extracelular regulada por quinasas
Extracellular signal‐regulated kinases
ERN Especies reactivas de nitrógeno
Reactive Nitrogen species
ERRα Receptor relacionado con los estrógenos α
Estrogen related receptor α
FFA Ácidos grasos libres
Free Fatty Acids
Foxo1 Factor de transcripción forkhead 1
Forkhead transciption factor 1
Foxo3a Factor de transcripción forkhead 3a
Forkhead transciption factor 3a
Gpx Glutatión peroxidasa
Glutathione peroxidase
GR Glutatión reductasa
Glutathione reductase
GSH Glutatión reducido
Reduced glutathione
GSSG Glutatión oxidado
Oxidized glutathione
Abreviaturas
28
H2O2 Hidroperóxidos
Hydroperoxides
HDL Lipoproteína de alta densidad
High density lipoprotein
HFD Dieta alta en grasa
High fat diet
HNE 4‐hidroxinonenal
HNF‐4α Factor nuclear hepatocitario 4 α
Hepatocyte nuclear factor 4 α
HOMA Índice de resistencia a la insulina
Homeostasis Model Assesment
HRP Peroxidasa de rábano
Horseradish peroxidase
HTA Hipertensión arterial
Arterial Hypertension
IASO Asociacion Internacional para el estudio de la Obesidad
International Association for the Study of Obesity
IDH Isocitrato deshidrogenasa
Isocitrate dehydrogenase
IL1 Interleuquina 1
Interleukin 1
IL6 Interleuquina 6
Interleukin 6
IMC/BMI Índice de masa corporal
Body mass Index
iNOS Oxido nítrico sintasa inducida
Inducible Nitric Oxide Synthase
IRS2 Receptor de Insulina 2
Insulin receptor 2
JNK c‐Jun N‐terminal quinasas
c‐Jun N‐terminal kinases
Abreviaturas
29
LASY Ácido lipoico sintasa
Lipoic acid synthase
LD Complejo lipoamida deshidrogenasa
Lipoamide dehydrogenase complex
LDL Lipoproteína de baja densidad
Low density lipoprotein
LXR Receptor nuclear hepático X
Liver X Receptor
MAHR/IRLM Mitocondrias aisladas de hígado de rata
Isolated rat liver mitocondria
MAPK Proteina quinasa activada por mitógenos
Mitogen‐activated protein kinase
MCP‐1 Proteína quimióstatica de monocitos
Monocyte chemotactic protein‐1
MDA Malonildialdehido
Malondialdehyde
MPP Peptidasas de matriz mitocondrial
Mitochondrial matriz peptidase
mtDNA DNA mitocondrial
Mitochondrial DNA
mtGpx Glutatión peroxidasa mitocondrial
Mitochondrial glutathione peroxidase
NAFLD Enfermedad hepática no alcohólica
Non‐alcoholic fatty liver disease
NAM Nicotinamida
Nicotinamide
Napmt Nicotinamida ribosil transferasa
Nicotinamide rybosil transferase
NASH Esteatohepatitis no alcohólica
Non‐alcoholic steatohepatitis
Ndufs2 NADH deshidrogenasa (ubiquinona) Fe‐S Proteína 2
NADH dehydrogenase (ubiquinone) Fe‐S protein 2
Abreviaturas
30
NO Oxido nítrico
Nitric Oxide
Nrf1 Factor respiratorio nuclear 1
Nuclear respiratory factor 1
Nrf2 Factor respiratorio nuclear 2
Nuclear respiratory factor 2
OAA Oxalacetato
Oxalacetate
O‐AADPR 2´‐O‐acetil‐ADP‐ribosa
2´‐O‐acetyl‐ADP‐ribose
OH*‐ Radical hidroxilo
Hydroxyl Radical
OLEFT Otsuka Long‐Evans Tokushima Fatty
OMS Organización Mundial de la Salud
Worl Health Organization
ONOO‐ Peroxinitrito
Nitrite peroxide
OXPHOS Fosforilación oxidativa
Oxidative phosphorilation
PAI‐1 Inhibidor de la activación de plásminógeno 1
Plasminogen activation inhibitor 1
Parp Poli‐ADP‐ribosa polimerasa
Poly ADP ribose polymerase
PDH Complejo piruvato deshidrogenasa
Pyruvate Dehydrogenase Complex
PEP Fosfoenol piruvato
Phosphoenolpyruvate
Pgc1α Coactivador 1 α activado por proliferadores peroxisomales γ
Peroxisome proliferator‐activated receptor gamma, coactivator 1 alpha
Pgc1β Coactivador 1 β activado por proliferadores peroxisomales γ
Peroxisome proliferator‐activated receptor gamma, coactivator 1 beta
Abreviaturas
31
PI3K Fosfotidilinositol 3‐quinasa
Phosphoinositide‐3‐kinase
PK Piruvato quinasa
Pyruvate Kinase
PON‐1 Paroxenasa 1
Paroxenase 1
Pparα Receptor del activador de la proliferación peroxisomal α
Peroxisome proliferator activated receptor alpha
Pparγ Receptor del activador de la proliferación peroxisomal γ
Peroxisome proliferator activated receptor gamma
Ppia Ciclofilina
Peptidylprolyl isomerase (cyclophilin)‐like 3
QH2 Ubiquinol/ Ubiquinol
RCN Especies reactivas de cloro
Chloride Reactive Species
RCR Ratio de control respiratorio
Respiratory control ratio
RI Resistencia a la Insulina
Insulinresistance
ROS Especies reactivas de oxígeno
Reactive oxygen species
RSV Resveratrol/ Resveratrol
SAM S‐adenosil metionina
S‐Adenosyl Methionine
SDH Succinato deshidrogensa
Succinate Dehydrogenase
SEEDO Sociedad Española para el Estudio de la Obesidad
Spanish Society to Study of Obesity
Sirt1 Sirtuina 1/ Sirtuin 1
Sirt3 Sirtuina 3/ Sirtuin 3
SIRTs Familia de las Sirtuinas
Silent mating type information regulation 2 homologue family
Abreviaturas
32
SM Síndrome metabólico
Metabolic Syndrome
Sod1 Superóxido dismutasa 1, isoforma citosólica depenciente de Cu‐Zn
Superoxide dismutase 1, cytosolic isoform, Cu‐Zn Sod
Sod2 Superóxido dismutasa 2, mitocondrial dependiente de manganeso
Superoxide dismutase2, mitocondrial manganese superoxide Sod
Srebp1 Factor de transcripción de la proteína de unión al elemento regulador
de esteroles 1
Sterol regulatory element binding transcription factor 1
TAM Tejido adiposo marrón
Brown adipose tissue
TBARS Especies reactivas del ácido tiobarbitúrico
Thiobarbituric acid reactive species
Tfam Factor de transcripción mitocondrial A
Mitochondrial transcription factor A
Tfb1m Factor de transcripción mitocondria B1
Mitochondrial transcription factor B1
Tfb2m Factor de transcripción mitocondria B2
Mitochondrial transcription factor B2
TG Triglicéridos
Triglycerydes
TGFβ Factor de crecimiento β
Transforming growth factor β
TNB Ácido 5‐thio‐2‐nitrobenzoico
5‐thio (2‐nitrobenzoic acid)
TNFα Factor de necrosis tumoral α
Tumor necrosis factor α
TTFA 4,4,4‐Trifluoro‐1,2‐Trienil‐1,3‐butadienona
4,4,4‐Trifluoro‐1‐(2‐thienyl)‐1,3‐butanedione
TXR Tioredoxina reductasa
Thiredoxin reductase
Abreviaturas
33
Ucp2 Proteína desacoplante 2
Uncoupling protein 2
Uqcrq Ubiquinol‐Cit c reductasa, complejo III subunidad VII
Ubiquinol‐cytochrome c reductase, complex III subunit VII
VC Vitamina C
Vitamin C
XOD Xantino oxidasa
Xanthine Oxidase
Índice
35
ÍNDICE
CAPÍTULO 1 INTRODUCCIÓN .................................................................................... 43
1.1 La obesidad.................................................................................................................. 45
1.2 Enfermedad hepática no alcohólica ............................................................................ 56
1.3 Estrés oxidativo ........................................................................................................... 65
1.4 La mitocondria ............................................................................................................. 71
1.5 Terapia antioxidante ................................................................................................... 99
1.6 Ácido lipoico .............................................................................................................. 105
1.7 Referencias bibliográficas ......................................................................................... 119
CAPÍTULO 2 HIPÓTESIS Y OBJETIVOS ...................................................................... 167
CAPÍTULO 3 MATERIAL Y MÉTODOS ....................................................................... 175
3.1 Estudio in vitro ........................................................................................................... 179
3.2 Estudios in vivo .......................................................................................................... 197
3.3 Referencias bibliográficas ......................................................................................... 245
CAPITULO 4 RESULTADOS ....................................................................................... 249
6.1 Vitamin c, Resveratrol and Lipoic acid actions on isolated rat liver mitochondria. .. 253
6.2 Erythrocyte as a potential biomarker of liver mitochondrial antioxidant status ...... 279
Índice
6.3 Lipoic acid administration prevents non‐alcoholic steatosis linked to long term high‐
fat..feeding by modulating mitochondrial function …………………………….……………………..……303
6.4 Lipoic acid improves mitochondrial function in non‐alcoholic steatosis through
the..stimulation of sirtuin 1 and sirtuin 3 ………………………………………….……………………………….341
CAPÍTULO 5 DISCUSIÓN GENERAL .......................................................................... 369
7.1 Discusión general ...................................................................................................... 371
7.2 Referencias bibliográficas ......................................................................................... 385
CAPÍTULO 6 CONCLUSIONES .................................................................................. 397
CAPÍTULO 7 RESUMEN ........................................................................................... 407
ANEXOS .................................................................................................................. 411
Índice de Ilustraciónes y figuras
37
ÍNDICE DE ILUSTRACIÓNES Y FIGURAS
CAPÍTULO 1: INTRODUCCIÓN
Ilustración 1 Balance energético positivo y acumulación de grasa. ............................................ 45
Ilustración 2 Valores promedio de IMC de varones jóvenes en diferentes países. ...................... 50
Ilustración 3 Modelo esquemático del desarrolló del síndrome metabólico. ............................. 53
Ilustración 4 Posibles mecanismos del origen del estrés oxidativo asociado a obesidad. .......... 54
Ilustración 5 Progresión de la NAFLD y evolución histológica ..................................................... 58
Ilustración 6 Teoría del “doble impacto” para el desarrollo de la NAFLD. .................................. 60
Ilustración 7 Metabolismo de los TG en el hígado. ..................................................................... 61
Ilustración 8 Disfunción mitocondrial en la esteatosis y posibles mecanismos de protección de
las defensas antioxidantes. ......................................................................................................... 64
Ilustración 9 Esquema del daño oxidativo producido en las diferentes estructuras celulares .... 66
Ilustración 10 Reacciones de formación de radicales libres. ....................................................... 68
Ilustración 11 Esquema de las principales defensas antioxidantes celulares. ............................ 69
Ilustración 12 Esquema de la estructura mitocondrial ................................................................ 72
Ilustración 13 Etapas finales de los procesos catabólicos que se desarrollan en la matriz
mitocondrial. ............................................................................................................................... 73
Ilustración 14 Esquema de la cadena de transporte de electrones y balance de protones ........ 76
Ilustración 15 Esquema del flujo de protones en la fosforilación oxidativa ................................ 80
Ilustración 16 Consumo de oxígeno en los diferentes estados respiratorios .............................. 81
Ilustración 17 Mapa del genóma mitocondrial en vertebrados .................................................. 83
Ilustración 18 Señales de regulación de la biogénesis mitocondrial que confluyen en el promotor
de Pgc1α o en Pgc1α. .................................................................................................................. 85
Ilustración 19 Red de regulación de la función mitocondrial dirigida por Pgc1α. ....................... 87
Ilustración 20 Producción de O2*‐ en la cadena de transporte de electrones. ............................. 90
Ilustración 21 Principales defensas antioxidantes mitocondriales y vías de formación de
especies reactivas desde O2*‐. ..................................................................................................... 91
Ilustración 22 Esquema del daño oxidativo en la mitocondria. Cyt c; citocromo c, PTM; poro de
transición mitocondrial. .............................................................................................................. 92
Ilustración 23 Localización celular de las diferentes sirtuinas. .................................................... 93
Índice de Ilustraciónes y figuras
38
Ilustración 24 Actividades enzimáticas de las SIRTs. Adaptado de Haigis et al (2010) ............... 94
Ilustración 25 Efectos de la Sirt1 en el metabolismo del tejido hepático en situación de ayuno.96
Ilustración 26 Esquema de los mecanismos de protección frente al estrés oxidativo mediados
por Sirt3. ..................................................................................................................................... 98
Ilustración 27 Estructura química de la Vitamina C .................................................................. 100
Ilustración 28 Metabolismo redox de la vitamina C.. ................................................................ 102
Ilustración 29 Estructura química del Resveratrol .................................................................... 104
Ilustración 30 Estructura del ácido lipoico (AL) ......................................................................... 106
Ilustración 31 Vías de transformación del ácido lipoico exógeno en modelos in vitro. ............ 107
Ilustración 32 Transformaciones químicas del AL en el hígado. ............................................... 109
Ilustración 33 Mecanismo posible de la activación de genes antioxidantes por el AL. ............. 111
Ilustración 34 Mecanismos de regeneración de antioxidantes endógenos por acción del AL. . 112
Ilustración 35 Resumen de módelos experimentales empleados .............................................. 177
Ilustración 36 Diseño experimental in vitro ............................................................................... 179
Ilustración 37 Imagen de la cavidad abdominal de rata Wistar (a) y partes del hígado (b) ..... 182
Ilustración 38 Protocolo de aislamiento de extractos mitocondriales de hígado de rata ......... 183
Ilustración 39 Esquema de la reacción para la determinación de O2*‐. ..................................... 186
Ilustración 40 Esquema del procedimiento para la determinación de la producción O2*‐ ........ 187
Ilustración 41 Esquema de la reacción para la determinación de hidroperóxidos .................... 187
Ilustración 42 Esquema del procedimiento para la determinación de la producción
hidroperóxidos ........................................................................................................................... 189
Ilustración 43 Esquema de las reacciones para la medida de la actividad superóxido dismutasa
................................................................................................................................................... 189
Ilustración 44 Esquema de las reacciones para la medida de la actividad glutatión peroxidasa
................................................................................................................................................... 191
Ilustración 45 Consumo de oxígeno en los diferentes estados respiratorios ............................ 195
Ilustración 46 Diseño experimental del estudio in vivo ............................................................. 198
Ilustración 47 Diseño experimental del estudio in vivo I ........................................................... 200
Ilustración 48 Diseño experimental in vivo II ............................................................................. 201
Ilustración 49 Reacción enzimática para la determinación de los niveles séricos de glucosa .. 202
Ilustración 50 Reacciones enzimáticas implicadas en la determinación de los niveles séricos de
AST ............................................................................................................................................. 202
Índice de Ilustraciónes y figuras
39
Ilustración 51 Reacciones enzimáticas implicadas en la determinación de los niveles séricos de
ALT. ............................................................................................................................................ 203
Ilustración 52 Fundamento teórico de la detección de los niveles de insulina por el método de
ELISA .......................................................................................................................................... 204
Ilustración 53 Micrografías de hígado de rata .......................................................................... 207
Ilustración 54 Reacción de formación de aductos de MDA‐TBA ............................................... 209
Ilustración 55 Esquema de las reacciones para la medida del contenido en glutatión ............ 214
Ilustración 56 Esquema de la RT‐qPCR según la metodología TaqMan. ................................... 218
Ilustración 57 Pasos principales de la técnica de Western Blot ................................................ 221
Ilustración 58 Esquema de reacciones para la determinación de la actividad del Complejo I .. 229
Ilustración 59 Conjunto de reacciones en las que se basa la determinación de la actividad del
Complejo II+III ............................................................................................................................ 231
Ilustración 60 Reacción en la que se basa la medida de la actividad del Complejo IV .............. 233
Ilustración 61 Reacciones implicadas en la medida de la actividad ATP sintasa ...................... 235
Ilustración 62 Reacciones catalizadas por la SDH y en las que se basa la medida de su actividad
................................................................................................................................................... 236
Ilustración 63 Reacciones implicadas en la medición de la actividad citrato sintasa ............... 238
Ilustración 64 Reacción en la que se basa la medida de los niveles de ATP por bioluminiscencia
................................................................................................................................................... 240
Ilustración 65 Determinación del daño en el mtDNA mediante RT‐qPCR ................................. 243
CAPÍTULO 4: RESULTADOS
CAPÍTULO 4.1: RESULTADOS I
Figure 1 Effects of different antioxidants on mitochondrial superoxide production……………… 261
Figure 2 Effects of antioxidants on mitochondrial hydroperoxide production ……………………….262
Figure 3 Influence of VC, RSV and LA on the activity of the main mitochondrial antioxidant
enzymes ……………………………………………………………………………………………………………………………….263
Figure 4 Changes in P/O ratio after treatment with antioxidants………………….........................266
CAPÍTULO 4.2: RESULTADOS II
Figure 1 Effects of HFD and LA on erythrocyte antioxidant defences.................................... 289
Índice de Ilustraciónes y figuras
40
Figure 2 Correlation between erythrocyte antioxidant defences and liver triglycerides.........290
Figure 3 Correlation between erythrocyte antioxidant defences and TBARS content............291
Figure 4 Correlation between erythrocyte antioxidant defences and mtDNA injury..............291
Figure 5 Correlation between the main antioxidant defences analyzed in erythrocytes and in
the hepatic mitochondrial compartment.................................................................................292
CAPÍTULO 4.3: RESULTADOS III
Figure 1 Changes in hepatic tryglyceryde content induced by HFD and LA..............................314
Figure 2 Effects of HFD and LA treatment in liver histopathology............................................317
Figure 3 Effects of HFD and LA on citrate synthase and succinate dehydrogenase activites....319
Figure 4 Activities of electron transport chain complexes.........................................................323
Figure 5 Changes in ATP synthase activity, mRNA levels of Atp5c1, mitochondrial ATP levels and
correlation between liver mitochondrial ATP levels and metabolic efficiency..........................324
CAPÍTULO 4.4: RESULTADOS IV
Figure 1 Effects of LA on liver damage and reactive oxygen species………………………………………352
Figure 2 Changes on mitochondrial antioxidant defenses in different experimental group……354
Figure 3 Effect of LA on mitochondrial biogenesis and mtdna damage…………………………………356
Figure 4 Effects of LA on Foxo3a and Pgc1β expresión and acetylation…………………………………358
Figure 5 Effects of LA on sirtuins pathway……………………………………………………………………………360
Índice de Tablas
41
ÍNDICE DE TABLAS
CAPÍTULO 1: INTRODUCCIÓN
Tabla 1 Criterios de la seedo para clasificar la obesidad ………………………………………………………..48
CAPÍTULO 3: MATERIAL Y MÉTODOS
Tabla 2 Composición nutricional de la dieta modelo in vitro…………………………………………………180
Tabla 3 Condiciones de utilización de los antioxidantes empleados en la incubación de
mitocondrias…………………………………………………………………………………………………………….………… 184
Tabla 4 Composición nutricional de las dietas experimentales………………………………………….… 197
Tabla 5 Descripción de los grupos experimentales modelo in vivo …………………………………….. 199
Tabla 6 Listado de genes y sondas utilizadas para el Qrt‐pcr……………………………………………… 220
Tabla 7 Anticuerpos empleados para la determinación de proteínas………………………………... 225
Tabla 8 Reactivos empleados en la medida de la actividad del complejo I………………………….230
Tabla 9 Reactivos empleados en la medida de la actividad del complejo II+III…………………. 232
Tabla 10 Reactivos empleados en la medida de la actividad del complejo II……………………….237
Tabla 11 Reactivos empleados en la medida de la actividad citrato sintasa……………………….239
CAPÍTULO 4: RESULTADOS
CAPÍTULO 4.1 RESULTADOS I
Table 1 Changes on respiratory parameters of VC, RSV and LA……………………………………………265
CAPÍTULO 4.2 RESULTADOS II
Table 1 Effects of diet and lipoic acid on obesity and oxidative markers. ……………………………..287
CAPÍTULO 4.3 RESULTADOS III
Table 1 Gene name and genbank accession number used in RT‐qPCR…………………………........ 310
Índice de Tablas
42
Table 2 Body, liver and wat weights, biochemical markers, calorie intake and feed efficiency in
lean and obese (high‐fat fed) rats…………………………………………………………………………………………313
Table 3 Effects of LA on mRNA levels of several genes involved in liver lipogenesis, β‐oxidation,
Ppars and Pgcs pathway…………………………………………………………………………………………………….. 321
CAPÍTULO 4.4 RESULTADOS IV
Table 1 Gene name and genbank accession number used in RT‐qPCR………………………………… 348
Table 2 Body weight gain, body composition, liver triglyceride content, calorie intake and
feeding efficiency in lean and obese rats……………………………………………………………………………….351
CAPÍTULO 1 / CHAPTER 1
Introducción/Introduction
Chapter 1 Introduction Capítulo 1 Introducción
45
1.1 LA OBESIDAD
1.1.1 DEFINICIÓN Y ETIOPATOGENIA
En la actualidad, la obesidad se define como una enfermedad crónica caracterizada por
un aumento de la masa grasa y, por lo tanto, del peso corporal, como consecuencia de
un balance energético positivo mantenido en el tiempo (Bray and Bouchard 2008). El
exceso de peso se asocia normalmente con un aumento de las reservas del organismo
en forma de grasa en relación con el promedio normal para la edad, sexo, talla y
complexión (Lumeng and Saltiel 2011, Redinger 2008, Sinha and Kling 2009, Bray and
Bouchard 2008).
La obesidad es una condición heterogénea y multifactorial en cuya aparición están
implicados numerosos factores etiológicos, entre los cuales la herencia y el estilo de vida
juegan un papel determinante (Valdecantos, Perez‐Matute and Martinez 2009).
Las relaciones entre la ingesta energética, el gasto energético, la composición nutricional
de la dieta y la adipogénesis determinan la cantidad de la reserva energética corporal
(Ilustración 1). Cuando la ingesta energética excede al gasto energético o la distribución
nutricional de la dieta favorece la reserva de lípidos, se produce un desequilibrio que
conlleva al desarrolló de sobrepeso y a largo plazo de obesidad (Loos and Bouchard
2003).
Ilustración 1 Balance energético positivo y acumulación de grasa. Diagrama que relaciona
el balance energético positivo con la acumulación de grasa, indicando los puntos de
actuación de la predisposición genética.
Capítulo 1 Introducción Chapter 1 Introduction
46
En la mayoría de los casos, la situación de obesidad no se debe a una única causa sino
que su origen es multifactorial, implicando diversos agentes. En muy pocas ocasiones la
causa de la obesidad es única (Apovian 2010, Egger and Dixon 2011, Musaiger 2011),
como en el caso de la deficiencia en leptina (Licinio et al 2004, Farooqi et al 2002) o la
mutación del receptor de melanocortina 4 (Yeo et al 2003, Vaisse et al 1998). A
continuación se detallan los principales factores causantes de obesidad descritos en la
literatura:
Factores genéticos: aunque se han identificado algunos casos de obesidad
monogénica en humanos, la obesidad humana es fundamentalmente de origen
poligénico (Hinney and Hebebrand 2008, Hinney, Vogel and Hebebrand 2010).
Uno de los genes relacionados con la obesidad que han sido más analizados en
los últimos años es el gen FTO (Labayen et al 2011, Moleres et al 2011, Muller
et al 2008).
Factores neuroendocrinos: en el año 1994, Zhang y colaboradores identificaron
la leptina, hormona con un importante papel en la regulación del peso corporal
(Myers et al 2010, Oswal and Yeo 2010). Posteriormente, se han identificado un
gran número de moléculas relacionadas con el control neuroendocrino de la
ingesta y del gasto energético que podrían desempeñar un papel importante en
la aparición de la obesidad como la adiponectina (Mangge et al 2010,
Matsuzawa 2010), la resistina (Lazar 2007), la grelina (Schellekens, Dinan and
Cryan 2010, Wiedmer et al 2007) o el receptor de la melanocortina 4 (MC4R)
(Scherag et al 2010, Wang et al 2010a).
Factores dietéticos y actividad física: la distribución de los substratos
energéticos de la dieta, y no solo la ingesta energética, es un importante factor
a tener en cuenta en el desarrolló de la obesidad ya que pueden tener un
impacto diferente sobre el metabolismo y el apetito, así como sobre la
respuesta del sistema nervioso simpático y por tanto en el balance energético y
en el peso corporal (Labayen and Martinez 2002, Martinez et al 2002). Por otro
lado el sedentarismo que se ha impuesto en los países occidentales provoca un
descenso en el gasto energético que ha contribuido de forma importante al
Chapter 1 Introduction Capítulo 1 Introducción
47
aumento de la obesidad principalmente en población infantil (Hills, Andersen
and Byrne 2011, Must and Parisi 2009, Steeves et al 2011).
Causas farmacológicas: como el consumo de algunos anti psicóticos, cortico
esteroides o β‐bloqueantes.
Causas psicosociales: Determinadas situaciones ambientales pueden
desencadenar respuestas emocionales que pueden llevar a ingerir una cantidad
excesiva de alimentos, produciéndose el fenómeno denominado “obesidad
reactiva”. Asimismo, en la mayoría de estudios epidemiológicos sobre la
obesidad se ha observado una relación inversa entre el nivel cultural y su
prevalencia, de modo que a menor nivel de formación se produce una mayor
incidencia de obesidad.
1.1.2 CLASIFICACIÓN
Existen diversos criterios en función de los cuales puede clasificarse la obesidad. El más
utilizado es el criterio cualitativo que se basa en el Índice de Masa Corporal (IMC) o
Índice de Quetelet. Se trata de un índice que relaciona el peso del individuo expresado
en kilogramos con la altura de dicho individuo, expresada en metros, y elevada al
cuadrado. Dicho índice es utilizado por la mayoría de estudios epidemiológicos y
recomendado por diversas sociedades médicas y organizaciones de salud
internacionales para su uso clínico, dada su reproducibilidad, facilidad de utilización y
capacidad de reflejar la adiposidad en la mayoría de la población (Salas‐Salvado et al
2007). De acuerdo con el Consenso SEEDO´2007 (Sociedad Española para el Estudio de la
Obesidad) esta clasificación queda establecida tal y como se muestra en la siguiente
tabla:
Capítulo 1 Introducción Chapter 1 Introduction
48
Tabla 1 Criterios de la SEEDO para clasificar la obesidad en función del IMC en adultos
Categoría Valores límites de IMC (Kg/m2)
Peso Insuficiente <18,5
Normopeso 18,5‐24,9
Sobrepeso grado I 25,0‐26,9
Sobrepeso grado II 27,0‐29,9
Obesidad tipo I 30,0‐34,9
Obesidad tipo II 35,0‐39,9
Obesidad tipo III (mórbida) 40,0‐49,9
Obesidad tipo IV (extrema) >50
Recientemente se ha definido un índice alternativo al IMC, el índice de adiposidad
corporal que refleja de forma más precisa el porcentaje de grasa acumulada y es
independiente del sexo y la raza (Bergman et al 2011). Este nuevo índice parece
interesante, aunque su utilidad debe ser validada por más trabajos.
Además de este criterio, la obesidad se puede clasificar en base a criterios etiológicos,
anatómicos o celulares. Para este estudio es de especial importancia la clasificación
según criterios anatómicos basada en la distribución de la grasa corporal (Serrano Rios,
Ordovas and Gutierrez Fuentes 2010). En base a esta clasificación los tipos de obesidad
serían:
Obesidad difusa o clase I: caracterizada por un exceso de grasa corporal total sin
que se produzca concentración específica de tejido adiposo en ninguna región
especial.
Obesidad central, androide o clase II: se caracteriza por un exceso de grasa
subcutánea a nivel abdominal y troncular. Esta obesidad suele asociarse a las
principales co‐morbilidades derivadas de la obesidad como la esteatosis
hepática o la DMT2.
Chapter 1 Introduction Capítulo 1 Introducción
49
Obesidad glúteo‐femoral, ginoide o clase III: caracterizada por un acumulo de
grasa principalmente en la región glúteo‐femoral. Suele asociarse a litiasis biliar,
tromboflebitis e hiperinsulinemia.
1.1.3 PREVALENCIA
La prevalencia de obesidad ha aumentado y continúa incrementándose de forma
alarmante tanto en países desarrollados como en países de economía de transición o no
desarrollados, adquiriendo proporciones epidémicas (Finucane et al 2011, Low, Chin and
Deurenberg‐Yap 2009). Según la OMS, en 2005 había en todo el mundo 1600 millones
de personas mayores de 15 años y 20 millones de menores de 5 años con sobrepeso, y
400 millones de personas con obesidad. Se estima que en el año 2015 habrá,
aproximadamente, 2300 millones de personas adultas con sobrepeso y más de 700
millones con obesidad. Los últimos análisis (2010) de la IASO (Asociación Internacional
para el Estudio de la Obesidad) estiman que aproximadamente 1000 millones de adultos
tienen sobrepeso y 475 millones son obesos. La IASO apreció que 200 millones de niños
en edad escolar sufren sobrepeso u obesidad, de los cuales entre 40 y 50 millones están
clasificados como obesos. En Europa aproximadamente el 60% de adultos y el 20% de
los niños en edad escolar tienen sobrepeso u obesidad. Traducido en números esto
implica aproximadamente 260 millones de adultos y 12 millones de niños que tienen
sobrepeso y/u obesidad en Europa.
Capítulo 1 Introducción Chapter 1 Introduction
50
Ilustración 2 Valores promedio de IMC de varones jóvenes en diferentes países. Tomada de
(Finucane et al 2011)
La prevalencia de obesidad en España, según la Encuesta Nacional de Salud 2006
publicada por el Ministerio de Sanidad Español, en población adulta es del 15,56% para
obesidad y si consideramos las situaciones de sobrepeso aumenta al 37,80%. En relación
a la prevalencia en niños y adolescentes, un estudio recientemente publicado (Febrero
2011) por la fundación THAO y llevado a cabo en 7 comunidades autónomas, muestra
que un 29,3% de los niños españoles sufre sobrepeso u obesidad. Una cifra que se
desglosa en una tasa del 21,1% de sobrepeso y del 8,2% cuando se contabiliza a
menores obesos con edades comprendidas entre los 3 y los 12 años. Un dato muy
significativo es el elevado índice de obesidad en población infantil de entre 3 y 5 años
(8,4%).
Especialmente preocupante es el aumento de la prevalencia de sobrepeso y obesidad en
niños y adolecentes (Baker et al 2010, Dehghan, Akhtar‐Danesh and Merchant 2005,
Han, Lawlor and Kimm 2010) debido a que se están teniendo que abordar algunas co‐
morbilidades asociadas a la obesidad como el síndrome metabólico (SM) (Abrams and
Levitt Katz 2011, Pacifico et al 2011a), la hipertensión (LaRosa and Meyers 2010) o la
Chapter 1 Introduction Capítulo 1 Introducción
51
esteatosis hepática (Widhalm and Ghods 2010, Weghuber et al 2011, Pacifico et al
2011b) en pacientes pediátricos lo cual acarrea una disminución importante en la
calidad de vida y un severo aumento del coste sanitario.
Este crecimiento exponencial ha convertido la obesidad en uno de los principales
problemas de salud pública en sociedades occidentales (Powers, Rehrig and Jones 2007)
estimándose que el coste económico en España derivado del tratamiento de la obesidad
y sus co‐morbilidades oscila en torno a los 5000 millones de euros anuales lo que
supone un 7% del gasto sanitario (Consenso SEEDO´2007 Sociedad Española para el
Estudio de la Obesidad) (Rubio 2007).
1.1.4 CO‐MORBILIDADES ASOCIADAS
La importancia clínica de la obesidad radica en sus complicaciones tal y como se ha
señalado previamente. La obesidad aumenta el riesgo de desórdenes metabólicos,
alteraciones cerebrovasculares, respiratorias, osteoarticulares e incluso determinados
tipos de cáncer (Hillon et al 2010, Prieto‐Hontoria et al 2011a). En este sentido, el
acúmulo de grasa corporal, principalmente en la región abdominal, está asociado a un
mayor riesgo de desarrollar DMT2 (DM2) (Das and Mukhopadhyay 2011, Eckel et al
2011), enfermedad cardiovascular (ECV) (Lavie, Milani and Ventura 2009, Artham et al
2009, Morse, Gulati and Reisin 2010) o esteatosis hepática (Cohen, Horton and Hobbs
2011, Moore 2010). Por otro lado, aumenta precozmente el desarrolló de
complicaciones metabólicas como dislipemias, hipertensión arterial, hiperinsulinemia,
hiperglucemia y resistencia a la insulina (RI), que en su conjunto caracterizan el SM
(Misra and Khurana 2008, Scaglione et al 2010, Barth 2011).
Los desórdenes clínicos asociados con la obesidad se generan bien como consecuencia
directa del aumento de la masa grasa o bien de manera secundaria, debido a que los
obesos presentan una actividad secretora del tejido adiposo alterada que puede afectar
al funcionamiento de distintos sistemas (Bray 2004, Bray and Bouchard 2008). A
continuación se resumen las alteraciones más comúnmente asociadas a la obesidad.
Enfermedad cardiovascular arterioesclerótica: cardiopatía isquémica,
enfermedad cerebrovascular etc.
Capítulo 1 Introducción Chapter 1 Introduction
52
Alteraciones cardiorrespiratorias: insuficiencia cardíaca congestiva, insuficiencia
ventilatoria, síndrome de apneas obstructivas del sueño etc.
Alteraciones metabólicas: resistencia a la insulina y DMT2, hipertensión arterial,
dislipemia aterógena e hiperuricemia.
Alteraciones en la mujer: disfunción menstrual, síndrome de ovarios
poliquísticos, infertilidad o aumento del riesgo perinatal.
Digestivas: colelitiasis, esteatosis hepática, esteatohepatitis no alcohólica,
cirrosis, reflujo gastroesofágico y hernia de hiato.
Músculo‐esqueléticas: artrosis, lesiones articulares y deformaciones óseas.
Otras alteraciones: insuficiencia venosa periférica, enfermedad
tromboembólica, cáncer, alteraciones cutáneas, alteraciones psicológicas y
psicosociales, disminución en la calidad de vida, trastornos del comportamiento
alimentario etc.
1.1.5 PAPEL DEL ESTRÉS OXIDATIVO EN EL DESARROLLÓ DE LA OBESIDAD Y ALGUNAS CO‐
MORBILIDADES ASOCIADAS
Numerosos datos publicados en los últimos años parecen indicar el papel central del
estrés oxidativo en el desarrollo de las co‐morbilidades asociadas a la obesidad
(D'Archivio et al 2011, Fernandez‐Sanchez et al 2011, Vincent, Innes and Vincent 2007).
Aunque no se conocen con exactitud los mecanismos, se ha sugerido que el aumento del
tejido adiposo blanco (TAB) conlleva una infiltración de macrófagos, que son
responsables de un aumento de la expresión de la NAD (P)H oxidasa y ésta, a su vez, es
la responsable de un aumento selectivo de la producción de ROS en el TAB (Ilustración
3). De esta manera, se genera un aumento del estrés oxidativo en el TAB que
desencadena una alteración en la secreción de adipoquinas la cual es causa del SM,
hipertensión arterial (HTA) y ateroesclerosis. En este proceso la resistencia a la insulina
en el hígado desarrolla un papel fundamental que se desarrollara más adelante en esta
tesis.
Chapter 1 Introduction Capítulo 1 Introducción
53
Ilustración 3 Modelo esquemático del desarrolló del síndrome metabólico. PAI‐1,
inhibidor del factor activador de plasminógeno tipo I; TAB, tejido adiposo blanco; TNFα,
factor de necrosis tumoral; ROS, especies reactivas de oxígeno (Valdecantos, Perez‐Matute
and Martinez 2009).
Así, en el estudio llevado a cabo por Furukawa y colaboradores se halló un aumento
selectivo en la expresión de algunas subunidades de la NAD(P)H oxidasa en el tejido
adiposo blanco en animales obesos y también se observó un aumento selectivo en la
producción de H2O2 en este tejido y en los niveles plasmáticos, estableciendo de esta
forma que el tejido adiposo es la principal fuente de ROS en situación de obesidad.
Asimismo, se analizaron diferentes indicadores de SM, como los niveles séricos de
glucosa e insulina, observando un aumento de dichos niveles en los animales con exceso
de peso que era revertido tras el tratamiento con un inhibidor de la NAD (P)H oxidasa
(apocinina) (Furukawa et al 2004). En una publicación reciente, Fortuño y colaboradores
apuntaban datos similares en pacientes obesos con SM en los que observaron tanto un
aumento en la producción de O2*‐ dependiente de NAD (P)H oxidasa como un aumento
en la expresión en algunas subunidades de esta enzima. Asimismo, estas investigaciones
establecieron una correlación positiva entre las concentraciones plasmáticas de insulina
Capítulo 1 Introducción Chapter 1 Introduction
54
y la producción de O2*‐ (Fortuno et al 2006). Por otro lado, parece que el aumento de la
expresión de NAD (P)H en el tejido adiposo puede estar relacionado con la infiltración de
macrófagos observada en dicho tejido, principalmente en el de tipo visceral (Curat et al
2006, Moreno‐Aliaga 2005).
A pesar de que estos datos contribuyan a clarificar los mecanismos de desarrolló del
estrés oxidativo asociado a obesidad, este desequilibrio no se produce por un único
mecanismo sino por la confluencia de varios factores y sus interacciones como se recoge
en la Ilustración 4.
Ilustración 4 Posibles mecanismos del origen del estrés oxidativo asociado a obesidad.
EO, estrés oxidante; FRAP, poder antioxidante del hierro; ROS, especies reactivas de
oxígeno; TA, tejido adiposo; TAS, capacidad antioxidante total del plasma (Valdecantos,
Perez‐Matute and Martinez 2009).
1.1.6 PAPEL DE LA DISFUNCIÓN MITOCONDRIAL EN LA OBESIDAD Y SUS CO‐
MORBILIDADES ASOCIADAS
Investigaciones recientes han establecido una relación entre la obesidad y algunas de
sus principales co‐morbilidades asociadas con una disfunción mitocondrial. Así, Rafaella
et al (2008) describieron en modelos animales de obesidad y resistencia a la insulina
inducida por una dieta alta en grasa (HFD), diferentes alteraciones en mitocondrias
Chapter 1 Introduction Capítulo 1 Introducción
55
hepáticas, principalmente una disminución de la eficiencia mitocondrial, aumento del
estrés oxidativo así como disminución en la capacidad respiratoria (Raffaella et al 2008).
Por otro lado, en ratones con obesidad inducida por la dieta se ha observado una
disminución en la expresión del gen de la frataxina mitocondrial, cuya ausencia se
encuentra relacionada con la enfermedad de Friedereich, una de las patologías
mitocondriales de mayor importancia (Pomplun et al 2007).
Por otro lado, estudios in vitro desarrollados en la línea celular murina 3T3‐L1, han
establecido una relación directa entre la disfunción mitocondrial y la disminución en la
síntesis de adiponectina (Koh et al 2007), lo cual se considera que es uno de los
mecanismos subyacentes al desarrolló de obesidad ligado al estrés oxidante. Además,
en los últimos años se ha propuesto el papel de la sirtuina 3 (Sirt3), localizada
principalmente en la mitocondria, como reguladora de la homeostasis energética (Ahn
et al 2008). Así, en estudios de restricción calórica llevados a cabo en modelos animales
de obesidad se observó una disminución en la producción de ROS, un aumento en la
biogénesis mitocondrial junto con una mejora en la función mitocondrial (Bevilacqua et
al 2005). Estos datos han dado lugar recientemente a la hipótesis de que la disfunción
mitocondrial puede hallarse en el inicio de las principales patologías metabólicas
(Raffaella et al 2008).
Por otro lado, la mayor parte de las anomalías metabólicas identificadas en el
metabolismo energético en situaciones de obesidad tienen como nexo de unión la
participación de la mitocondria. Así, las tres principales disfunciones relacionadas con el
metabolismo energético asociadas a obesidad son; la disminución de la grasa así como
una mayor dependencia de la glucosa para la síntesis de ATP, aumento de la
acumulación de grasa en el músculo esquelético y en el hígado principalmente y una
baja concentración basal de ATP. Todas ellas parecen tener su origen en diferentes
alteraciones en la mitocondria como ha sido propuesto por Rogge et al (2009) (Rogge
2009).
Por otro lado, Raffaella et al (2008) describieron alteraciones en el compartimento
mitocondrial hepático en modelos animales de obesidad inducida por la dieta (Raffaella
et al 2008). Así, estos animales desarrollaron esteatosis hepática y resistencia a la
insulina tras la alimentación con una dieta alta en grasa. Las principales alteraciones
Capítulo 1 Introducción Chapter 1 Introduction
56
mitocondriales descritas fueron el aumento del estrés oxidativo, la disminución en las
capacidades respiratoria mitocondrial y una aumento en el tamaño de las mitocondria
que se acompaño con una disminución en la eficiencia de las mismas (Raffaella et al
2008). Estos datos sugieren que las modificaciones observadas en el compartimento
hepático mitocondrial pueden preceder y contribuir al ulterior desarrolló de resistencia
a la insulina y de otras enfermedades metabólicas.
1.2 ENFERMEDAD HEPÁTICA NO ALCOHÓLICA
La enfermedad hepática no alcohólica (NAFLD) es una enfermedad inflamatoria hepática
de carácter crónico que engloba un espectro de patologías que van desde la
acumulación simple de grasa o esteatosis hepática, hasta fases finales de la enfermedad
como la cirrosis, pasando por la esteatohepatitis no alcohólica (NASH) y la fibrosis (Vanni
et al 2010, Mark, de Alwis and Day 2010, Bellentani and Marino 2009). A pesar de que
hace cuatro décadas ya se había descrito la presencia de esteatosis, inflamación y
fibrosis en el hígado de individuos obesos así como de pacientes operados de bypass
intestinal (Bondar and Pisesky 1967, Moxley, Pozefsky and Lockwood 1974, Payne,
Dewind and Commons 1963, Zelman 1952), no es hasta 1980 cuando Ludwig et al (1980)
(Ludwig et al 1980) acuñaron el término de NAFLD, basados en dos criterios principales:
cambios grasos con hepatitis lobular y ausencia de alcoholismo.
La NAFLD constituye probablemente la tercera causa de enfermedad hepática, tras la
hepatopatía alcohólica y el virus de la hepatitis C (Francque et al 2011, Guajardo‐Salinas
and Hilmy 2010, Browning et al 2004). Por su estrecha asociación con la obesidad y la
elevada prevalencia de ésta, hay autores que consideran a la NAFLD como la causa más
frecuente de hepatopatía en las sociedades occidentales. Aunque en sus primeros
estadios la NAFLD es una condición benigna, reversible, asintomática y con pocas
complicaciones clínicas asociadas puede progresar de forma irreversible a
esteatohepatitis no‐alcohólica (NASH) y otras formas más graves de NAFLD como la
fibrosis y la cirrosis con complicaciones graves, por lo que el control de esta progresión
es un paso crítico en la prevención y tratamiento de la NAFLD (Qureshi and Abrams
2007, Day 2006, Cortez‐Pinto, de Moura and Day 2006, Clark, Brancati and Diehl 2002).
Chapter 1 Introduction Capítulo 1 Introducción
57
1.2.1 PREVALENCIA DE LA NAFLD
Actualmente no existe un índice diagnóstico rápido y preciso para la confirmación de la
presencia que NAFLD lo que hace que los estudios de prevalencia usen una gran
variabilidad de base de datos. Las estimaciones más precisas proceden de las obtenidas
en estudios que se desarrollan en pacientes que han fallecido de forma accidental así
como en estudios de muestreo llevados a cabo en la población general (Francque et al
2011, Guajardo‐Salinas and Hilmy 2010, Browning et al 2004). Así, estudios llevados a
cabo mediante ultrasonografía en la población general de Japón e Italia (Bellentani and
Marino 2009, Lonardo et al 1997, Nomura et al 1988) sitúan la prevalencia de la
enfermedad en un 23 y 16% respectivamente. Dos estudios mediante resonancia
magnética espectroscópica detectaron la presencia de esteatosis hepática en un 31% de
los adultos (Browning et al 2004) y en un 33% de los potenciales donantes vivos
sometidos a una biopsia hepática en Estados Unidos (Ryan et al 2002). Por tanto las
actuales estimaciones sitúan la prevalencia de la NAFLD en un 20‐30% y la NASH en un
2‐5% de la población general, estimándose que un 19% de estos últimos evolucionan a
cirrosis, aunque según criterios histológicos estrictos como la balonización o fibrosis la
incidencia disminuye (2‐5%) (McCullough 2002, Marchesini et al 2003, Youssef and
McCullough 2002).
1.2.2 OBESIDAD Y NAFLD
En el estudio Dyonisos (Bellentani and Marino 2009) desarrollado en el norte de Italia, se
observó que un 76% de las personas obesas tenían evidencias ecográficas de esteatosis
hepática frente a un 15 % entre las que no tenían sobrepeso u obesidad. Por otro lado,
la revisión detallada de otros estudios epidemiológicos realizados en amplias muestras
de población indican que la obesidad aumenta el riesgo de tener elevadas
concentraciones de enzimas hepáticas entre 2 y 3 veces, mientras que el riesgo de
esteatosis ecográfica aumenta 3 veces en las personas con sobrepeso y hasta 15 veces
en situaciones de obesidad (Marchesini et al 2008). Estos datos se han confirmado en
diferentes estudios en cohortes de pacientes con obesidad mórbida en los que se ha
observado que la mayoría de los pacientes padecía esteatosis (85‐98%) y que alrededor
de un tercio tenía signos histológicos de esteatohepatitis (37%) de los cuales entre un
20‐40% presentaron estadios avanzados de fibrosis (Machado, Marques‐Vidal and
Capítulo 1 Introducción Chapter 1 Introduction
58
Cortez‐Pinto 2006, Dixon, Bhathal and O'Brien 2001, Garcia‐Monzon et al 2000, Marceau
et al 1999).
Teniendo en cuenta estos datos, actualmente se considera que la esteatosis es la
principal manifestación hepática del SM (Farrell and Larter 2006, Marchesini et al 2003,
Marchesini et al 2008, Schindhelm et al 2006), definido este como la asociación de al
menos tres de las siguientes alteraciones: resistencia a la insulina, obesidad central,
hipertensión arterial y dislipemias (Kassi et al 2011). Como explicaremos más delante de
especial importancia para la progresión de la NAFLD son las dos primeras alteraciones
que constituyen el primer factor de la teoría del “doble impacto” en el desarrollo de la
enfermedad hepática (Day 2002a).
1.2.3 PROGRESIÓN DE LA NAFLD
La esteatosis hepática constituye el principal factor desencadenante del primer estadio
de la NAFLD y consiste en una acumulación ectópica de triglicéridos en el interior de los
hepatocitos en forma de vesículas, sin causar inflamación ni muerte celular. El siguiente
estadio de la enfermedad es la NASH, caracterizada por la presencia de focos
inflamatorios ricos en neutrófilos y macrófagos y muerte hepatocitaria. Posteriormente,
el paciente puede desarrollar fibrosis y en situaciones más graves cirrosis (Ilustración 5).
Ilustración 5 Progresión de la NAFLD y evolución histológica
Chapter 1 Introduction Capítulo 1 Introducción
59
El hecho de que la esteatosis hepática sea una situación reversible mientras que la
esteatohepatitis no lo sea convierte a este tránsito en un punto sin retorno para el
progreso de la enfermedad. Es, por tanto, importante conocer cuáles son los
mecanismos implicados en la instauración del hígado graso y cuáles son los procesos y
agentes defensivos que se ven afectados por la acumulación grasa y que hacen al
hepatocito vulnerable al segundo impacto responsable de la evolución de la NAFLD
(Browning and Horton 2004, Day 2006).
1.2.3.1 Teoría del doble impacto
La teoría del doble impacto es la más aceptada entre la comunidad científica para
explicar la progresión de NAFLD (Garcia‐Monzon et al 2011, Rombouts and Marra 2010,
Lewis and Mohanty 2010) (Ilustración 6). Esta teoría postula que una primera agresión
provoca la acumulación de grasa en el hígado y esta situación hace al hepatocito más
sensible a desarrollar una respuesta inflamatoria que conduce a la evolución a la NASH
(Day 2002a, Day 2002b, Day 2006). La investigación actual apunta a que una
combinación de agentes medioambientales, genéticos y metabólicos provocan el
establecimiento y el avance de la enfermedad (Krawczyk, Bonfrate and Portincasa 2010,
Garcia‐Monzon et al 2011). La resistencia a la insulina se considera el factor
fisiopatológico individual más importante en el desarrollo de la esteatosis (Browning and
Horton 2004, Vanni et al 2010, Garcia‐Monzon et al 2011). De no adaptarse a él, el
hepatocito se vuelve disfuncional pudiendo producirse muerte celular por necrosis y
apoptosis y el subsiguiente fallo hepático (James and Day 1999, Chitturi and Farrell
2001). Si se adapta, el hepatocito preserva su viabilidad funcional pero se vuelve más
vulnerable ante aquellos estímulos que desencadenan una respuesta inflamatoria. De la
intensidad y duración en el tiempo de estos estímulos va a depender el grado de la
respuesta inflamatoria y de muerte celular (Day 2002a). En este segundo impacto
pueden verse implicados factores autocrinos, paracrinos y endocrinos capaces de
desencadenar estrés oxidativo, peroxidación lipídica (Sanyal et al 2001), producción
anormal de citoquinas así como de inducir disfunción mitocondrial y desórdenes en el
metabolismo de ácidos grasos (James and Day 1999). La inflamación crónica del tejido
hepático puede provocar, además, un aumento de la concentración de mediadores pro
inflamatorios, que activan de forma paracrina la fibrogénesis en las células estrelladas
Capítulo 1 Introducción Chapter 1 Introduction
60
(Rombouts and Marra 2010, Krawczyk, Bonfrate and Portincasa 2010, Farrell and Larter
2006).
Tejido normal Esteatosis Esteatohepatitis Fibrosis Cirrosis
TEJIDO ADIPOSO
APOPTOSIS
APOPTOSIS
NECROSIS
Activación céls. Kupffer
Activación céls. estrelladas
RESISTENCIA A LA
INSULINA↑Ácidos grasos
INFLAMACIÓNESTRÉS OXIDATIVO
PRIMER IMPACTO
SEGUNDOIMPACTO
OBESIDADDIABETES
DISFUNCIÓN MITOCONDRIAL
Ilustración 6 Teoría del “doble impacto” para el desarrollo de la NAFLD.
A. Primer impacto
Actualmente se considera que la resistencia a la insulina constituye el pilar básico
patogénico de la esteatosis hepática ya que puede interferir el metabolismo hepático
de los ácidos grasos a diferentes niveles. Se ha descrito que la RI produce un aumento
de flujo de ácidos grasos libres (FFA) al hígado debido al incremento de la hidrólisis de
los triglicéridos (TG) por la lipasa adipocitaria (Lewis et al 2002). Por otro lado, la
hiperinsulinemia y el aumento de la gluconeogénesis hepática inducida por la RI
estimulan la expresión de la proteína de unión al elemento regulador de esteroles 1
(Srebp1) y la de la proteína de unión al elemento de respuesta a carbohidratos (Crebp)
que son responsables de la estimulación de la lipogénesis de novo a nivel hepático
Chapter 1 Introduction Capítulo 1 Introducción
61
(Ilustración 7) (Cohen, Horton and Hobbs 2011). Además, la Srebp1 inhibe la
transcripción del substrato del receptor de insulina 2 (IRS2) lo que induce un aumento
en la RI a nivel hepático (Ide et al 2004).
Ilustración 7 Metabolismo de los TG en el hígado. Adaptada de Cohen et al (2011)
Como muestra la ilustración 7, el aumento del flujo de ácidos grasos libres además de
por la vía anterior puede provenir del tejido adiposo visceral a través de la vena porta,
siendo esta la principal fuente de FFA a nivel hepático. Esta teoría se ha visto
demostrada en estudios clínicos realizados en pacientes con NALD en los que se
demostró que la mayoría del contenido de TG hepáticos provenía del pool circulante
de FFA (60%), mientras que un 25% de la síntesis de novo de ácidos grasos y tan sólo
un 15% de la dieta (Donnelly et al 2005).
Por otro lado, se ha demostrado que la insulina (Petersen et al 2003) inhibe la β‐
oxidación mitocondrial al producir la activación, mediada por Srebp1‐1c de la isoforma
2 de la AcCoA carboxilasa que produce malonil‐CoA a nivel de la membrana interna
mitocondrial (Abu‐Elheiga et al 2000). Además, el aumento de malonil‐CoA disminuye
Capítulo 1 Introducción Chapter 1 Introduction
62
la β‐oxidación a través de la inhibición de la proteína transportadora de ácidos grasos
carnitina palmitoil transferasa (Cpt1) (Ilustración 7). Esta inhibición de la β‐oxidación
mitocondrial hace que se produzca un flujo elevado de ácidos grasos hacia su
incorporación en triglicéridos, ésteres de colesterol y fosfolípidos. El destino de los
lípidos complejos es específico del tipo celular en cuestión. En los hepatocitos, o bien
se empaquetan en las VLDL si la célula dispone de apolipoproteína B100 (apoB100)
suficiente y se secretan al torrente sanguíneo; o se almacenan en el citoplasma celular
en forma de vacuolas lipídicas.
B. Segundo impacto
Los principales responsables del “segundo impacto” en la progresión de la NAFLD son
el estrés oxidativo y la citoquinas proinflamatorias secretadas por el tejido adiposo.
Así, la peroxidación lipídica inducida por las ROS podría explicar el daño en la
membrana plasmática y mitocondrial causando la muerte celular por necrosis y
apoptosis y la aparición de megamitocondrias (Pessayre 2007, Pessayre et al 2001). El
aumento de ROS también induce la expresión del ligando de Fas a nivel hepático que
puede inducir la apoptosis de los hepatocitos que se ha descrito en pacientes con
NASH (Feldstein et al 2003). Por otro lado, algunos productos finales de la
peroxidación lipídica como el 4‐hidroxinonenal (HNE) o el malondialdehído (MDA)
pueden formar aductos proteícos que actúen como antígenos generando una
respuesta inmune intrahepática (Albano 2008), además tienen capacidad de unión a
citoqueratinas formando hialina de Mallory y pueden estimular la quimiotaxis de
neutrofilos (Cortez‐Pinto, de Moura and Day 2006). También se han encontrado
marcadores de estrés oxidativo como las proteínas nitradas en tirosina en modelos
animales y en pacientes con NAFLD que relacionan el grado de estrés con la gravedad
de la enfermedad hepática (Seki et al 2002).
En cuanto a la producción de ROS en el hígado, además de las células inflamatorias los
hepatocitos son una importante fuente de ROS en situaciones de NAFLD. Este
fenómeno se debe en primer lugar al incremento de flujo de FFA hacia los hepatocitos
inducido por la obesidad (Day 2002c). Los FFA son ligandos del activador de la
proliferación peroxisomal α ( Pparα) que, a su vez, estimula la transcripción de genes
implicados en la oxidación de los ácidos grasos contribuyendo a la formación de ROS
Chapter 1 Introduction Capítulo 1 Introducción
63
en los peroxisomas, el retículo endoplasmático y principalmente en las mitocondrias
(Reddy and Rao 2006, Laurent et al 2005).
El segundo factor a tener en cuenta en la progresión de la NAFLD son las citoquinas
pro‐inflamatorias que son capaces de inducir fenómenos de apoptosis y necrosis y la
quimiotaxis de neutrofilos, además pueden activar las células estelares hepáticas así
como la hialina de Mallory (Diehl et al 2005). Al mismo tiempo, algunas citoquinas pro‐
inflamatorias como el factor de necrosis tumoral (TNFα), y las interleuquinas 1 y 6 (IL1,
IL6) desempeñan un papel central en la patogenia de la RI sistémica y hepática
presente en los pacientes con NAFLD (Arkan et al 2005). Por otro lado, evidencias
experimentales indican que la leptina (Angulo et al 2004, Javor et al 2005) y la
adiponectina (Kaser et al 2005b, Kaser et al 2005a, Bugianesi et al 2005) podrían jugar
un papel fundamental en el desarrollo de la NAFLD.
1.2.3.2 Disfunción mitocondrial
En pacientes con NAFLD se han observado diferentes alteraciones de la funcionalidad
mitocondrial como reducción en la actividad de los complejos de la cadena de
transporte de electrones (CTE) (Browning and Horton 2004), fosforilación oxidativa
(OXPHOS) deficiente y un descenso en la concentración de ATP intracelular (Pessayre
2007), estrés oxidativo (Peng et al 2011, Dhibi et al 2011, Narasimhan et al 2010) y
anomalías ultraestructurales (Pessayre 2007, Sanyal et al 2001) y fundamentalmente
daño en el mtDNA (mtDNA) (Carabelli et al 2011, Kawahara et al 2007).
Se puede considerar que las causas de una menor capacidad de producir ATP son dos: 1)
la interrupción o el bloqueo de la cadena respiratoria en cualquier punto, lo que provoca
una reducción en el transporte de electrones en todos los complejos anteriores, que se
verán forzados a donar los electrones a la molécula de oxígeno; y 2) la disipación del
gradiente de protones a ambos lados de la membrana mitocondrial interna que impulsa
a la ATP sintasa. Al igual que otros tipos celulares, los hepatocitos pueden desarrollar
mecanismos adaptativos ante estas situaciones para mantener un flujo de electrones
similar al de un tejido normal. Para ello, principalmente, aumentan el tamaño de las
mitocondrias y de las crestas mitocondriales, lo que conlleva un aumento en la síntesis
de las proteínas de los complejos respiratorios y en la disponibilidad de la coenzima Q
Capítulo 1 Introducción Chapter 1 Introduction
64
(CoQ) (Pessayre 2007). Estas variaciones en el funcionamiento de la cadena de
transporte de electrones se pueden deber tanto a una disfunción mitocondrial como a
mecanismos de disipación de la energía a través de las proteínas desacoplantes (UCPs)
(Pecqueur et al 2001, Gonzalez‐Muniesa et al 2006).
Ilustración 8 Disfunción mitocondrial en la esteatosis y posibles mecanismos de
protección de las defensas antioxidantes. En rojo se muestran los efectos del aumento de
ROS (1) y en azul los que produciría una activación de las defensas antioxidantes (2 y 3). Las
puntas de flecha indican activación y las rayas transversales inhibición. Adaptada de Buqué
et al (2008)
La formación de ROS y el daño de las estructuras mitocondriales tiene un papel central
en la inducción de la disfunción mitocondrial (Ilustración 8). Así, en la mitocondria, las
ROS pueden interactuar tanto con fosfolípidos de la membrana como con proteínas
como el transportador de nucleótidos de adenina (ANT) y con los complejos de la
cadena respiratoria cambiando sus propiedades (Pessayre et al 2001) y
comprometiendo el transporte de electrones y el bombeo de protones al espacio
Chapter 1 Introduction Capítulo 1 Introducción
65
intermembrana (1) (Ilustración 8). La incorporación de protones a la matriz mitocondrial
promovida por los propios ácidos grasos y por el exceso de ROS puede puentear a la ATP
sintasa, decayendo la fuerza impulsora que promueve la síntesis de ATP y, por tanto,
tanto su síntesis y su posterior exportación vía ANT, se ven comprometidas. Un
transporte de electrones defectuoso exacerba la producción de ROS que va a incentivar
la peroxidación lipídica y la disfunción mitocondrial.
Sin embargo, si se consigue la activación de la proteína desacoplante 2 (Ucp2) ésta
puede disipar la sobrecarga de protones transformando la energía acumulada en el
gradiente electroquímico en forma de calor y además comportarse como un mecanismo
de defensa antioxidante (2) (Pecqueur et al 2001, Brand et al 2004, Ricquier 2005). Por
otro lado, la activación de las defensas antioxidantes mitocondriales como mecanismo
compensatorio podría neutralizar las ROS (3) y conseguirse asi una disminución de la
eficiencia energética sin daño de la función mitocondrial.
1.3 ESTRÉS OXIDATIVO
1.3.1 DEFINICIÓN
El estrés oxidativo ha generado recientemente mucho interés, debido
fundamentalmente a su papel principal en la etiología del envejecimiento y de múltiples
patologías con gran impacto en la salud pública como la hipertensión, obesidad y la
diabetes (Andreyev, Kushnareva and Starkov 2005). El término estrés oxidativo no está
claramente definido. En esencia, el estrés oxidativo está causado por un desequilibrio
entre la producción de radicales libres y las defensas antioxidantes del organismo
responsables de la detoxificación de dichos radicales (Vincent et al 2006).
Existen diferentes tipos de especies reactivas: ROS, especies reactivas del cloro (RCN) y
especies reactivas del nitrógeno (ERN). Todas estas especies reactivas contienen
radicales libres y partes no reactivas. Los radicales libres pueden definirse como
moléculas o fragmentos de moléculas que contiene uno o más electrones despareados
en los orbitales atómicos o moleculares (Halliwell 1999). Este electrón desapareado
confiere a los radicales libres una elevada reactividad (Cadenas 1989). Las ROS son
Capítulo 1 Introducción Chapter 1 Introduction
66
moléculas que contienen oxígeno y son altamente reactivas en los tejidos. Dentro de las
ROS se incluyen el anión superóxido (O2*‐), hidroperóxido (H2O2), radical hidorxilo (OH*‐),
óxido nítrico (NO), hipoclorito y el peroxinitrilo (ONOO‐) (Halliwell and Whiteman 2004).
La producción de estas especies reactivas en el organismo es necesaria para un correcto
mantenimiento de las funciones celulares, de hecho, las ROS son utilizadas en la
inducción y el mantenimiento de vías de señalización relacionadas con el crecimiento y
la diferenciación celular. Normalmente las especies reactivas se encuentran en equilibrio
con los sistemas antioxidantes del organismo, sin embargo determinadas patologías
como la enfermedad de Alzheimer (Butterfield 2002), la ateroesclerosis (Chowienczyk et
al 2000), algunos tipos de cáncer (Hagen et al 1994), las enfermedades
neurodegenerativas (Halliwell 2001) o el envejecimiento producen una ruptura de este
equilibrio, produciéndose un exceso en la producción de radicales libres, que por su
elevada reactividad, producen daños celulares a diferentes niveles de las estructuras
celulares (DNA, proteínas y lípidos) (Yu and Chung 2006) (Ilustración 9).
Ilustración 9 Esquema del daño oxidativo producido en las diferentes estructuras
celulares
Chapter 1 Introduction Capítulo 1 Introducción
67
1.3.2 PRODUCCIÓN DE ESPECIES REACTIVAS DE OXÍGENO
Como se ha descrito anteriormente las principales especies reactivas en el organismo
son las ROS y las ERN, a continuación se explicaran brevemente los mecanismos de
producción de las mismas:
Especies reactivas de oxígeno: estas especies se producen a partir de una primera
desestabilización de la molécula de oxígeno, considerada birradical y de poca
reactividad. Cuando un electrón reduce la molécula de oxígeno, se produce el O2*‐, esta
especie es altamente reactiva y por tanto la vida media es muy baja, además es la más
dañina para las estructuras celulares. El O2*‐ puede transformase en H2O2 a través de una
reacción de dismutación (Fridovich 1983), o por reacciones enzimáticas de
detoxificación, la reactividad de esta molécula es la menor de todas las ROS si bien su
vida media es la más elevada. Los H2O2 en presencia de metales de transición
reductores, como el cobre o el hierro, son convertidos en OH*‐, altamente reactivo, a
través de reacciones de Fenton o Haber‐Weiss. El OH*‐ posee una elevada reactividad,
siendo muy dañino para el organismo, de hecho es el mayor oxidativo de la naturaleza y
además tiene una vida media muy corta (Pastor et al 2000). El principal sistema
biológico de producción de ROS es la mitocondria, responsable principal de la
producción de O2*‐, principalmente en el complejo I (NADH deshidrogenasa) y el
complejo III (ubiquinona citocromo bc1) de la CTE (Boveris and Cadenas 1975, Orrenius,
Gogvadze and Zhivotovsky 2007, Turrens, Alexandre and Lehninger 1985), aunque
existen otras fuentes como la oxido nítrico sintasa (Alp and Channon 2004, Vasquez‐
Vivar and Kalyanaraman 2000, Vasquez‐Vivar et al 1998), las cicloxigenasas
(Chandrasekharan and Simmons 2004), lipoxigenasas (Wittwer and Hersberger 2007),
citocromo P450 reductasa (Zangar, Davydov and Verma 2004), la xantino oxidasa
(McCord and Fridovich 1968, Pacher, Nivorozhkin and Szabo 2006) y la NADPH oxidasa
localizada en la membrana plasmática de las células polimorfonucleares, macrófagos y
células endoteliales (Babior 2000, Babior, Lambeth and Nauseef 2002, Vignais 2002).
Especies reactivas de nitrógeno: la principal de estas especies es NO que se produce
tras la reacción de un átomo de nitrógeno con uno de oxígeno, resultando una molécula
con un número impar de electrones. El NO desde el punto de vista físico es un radical
libre, pero químicamente no se comporta como tal, ya que no posee ninguna reacción
Capítulo 1 Introducción Chapter 1 Introduction
68
de propagación. Sin embargo, posee una elevada afinidad por el O2*‐ dando lugar a
ONOO‐.
Las principales reacciones de formación se recogen en la siguiente ilustración:
Ilustración 10 Reacciones de formación de radicales libres. En azul se representan las
especies no reactivas; en rojo los ROS y en verde los ERN. Las flechas rojas indican las vías
de formación de especies reactivas.
1.3.3 DEFENSAS ANTIOXIDANTES
La otra parte del equilibrio oxidativo son los antioxidantes. Los antioxidantes han sido
definidos como “compuestos químicos que hallándose presentes en baja concentración
con respecto a las de un substrato oxidable, retardan o previenen la oxidación de dicho
substrato” (Halliwell 1999). Así, los efectos dañinos resultantes de la formación de ROS
son contrarrestados por varios sistemas antioxidantes. Las defensas antioxidantes del
organismo frente a los ROS y los radicales libres han sido extensamente estudiadas y
revisadas en varias publicaciones (Kris‐Etherton et al 2004, Levy et al 2004, Schrauzer
2006, Sharoni et al 2004, Smith et al 2004). Estas defensas engloban tanto sistemas
enzimáticos como no enzimáticos.
En relación a los primeros están formados por complejos enzimáticos (Yu 1994,
Stadtman 2004), que a través de diferentes reacciones transforman las especies
Chapter 1 Introduction Capítulo 1 Introducción
69
reactivas más dañinas en formas menos perjudiciales (Ilustración 11). Las principales
enzimas antioxidantes son la superóxido dismutasa (Sod) en sus dos isoformas: la
dependiente de cobre y zinc localizada en el citosol (Sod1) y la dependiente de
manganeso que se expresa en la mitocondria (Sod2), la catalasa (Cat) y la glutation
peroxidasa (Gpx) (Yu 1994). La Sod transforma el O2*‐ producido principalmente en la
cadena respiratoria, que es altamente reactivo y muy inestable en H2O2, el cual es
menos dañino para la célula (Ilustración 11). Por otro lado la Cat y la Gpx transformaran
este metabolito en agua (Stadtman 2004). Además de estas enzimas existen otras como
la Paraoxonasa‐1 (PON‐1) que es una enzima sérica encargada de combatir la
peroxidación de las LDL (Marchegiani et al 2008).
P450 oxidasa
Citocromob5
FADH2
oxidasa
Xantinoxidasa
Cadena respiratoria
oxidasas
PEROXISOMA
CITOSOL
RE
Canal aniónico
Hipoxia
Ilustración 11 Esquema de las principales defensas antioxidantes celulares. CAT; catalasa,
Cu, Zn‐SOD; cobre zinc superóxido dismutasa, Gpx; glutatión peroxidasa, GSH; glutatión
reducido, GSSG; glutatión oxidado, GR; glutatión reductasa, Sod2; manganeso superóxido
dismutasa, RE; retículo endoplásmico. Adaptada de Cayman Chemical Company
En relación a las sustancias antioxidantes de naturaleza no enzimática, se encuentran
aquellas que por su estructura y reactividad son capaces de neutralizar los radicales
Capítulo 1 Introducción Chapter 1 Introduction
70
libres, formando compuestos químicamente estables. Cuanto más estables y mayor
afinidad por los radicales libres poseen mayor será el poder antioxidante de las mismas
(Spiteller 2003). Así, dentro de las principales sustancias antioxidantes de naturaleza no
enzimática se pueden considerar dos grupos principales. El primero de ellos son las
sustancias de naturaleza endógena, constituido principalmente por los compuestos con
grupos tioles en su composición entre los que destaca el glutatión reducido (GSH) que al
mantener el equilibrio con su forma oxidada (GSSG) mantiene el balance redox celular
(Dickinson et al 2003). En cuanto a las sustancias antioxidantes exógenas se pueden
dividir en tres grandes grupos: las vitaminas antioxidantes (vitamina E, vitamina C y
vitamina A o β‐caroteno), los minerales con capacidad antioxidante (selenio, zinc, cobre
y manganeso) y, por último, diferentes fitoquímicos (el ácido lipoico, el resveratrol, las
catequinas y los compuestos fenólicos) (Rodrigo, Guichard and Charles 2007).
La vitamina E fue una de las primeras sustancias antioxidantes a la que se le atribuyó un
papel en la prevención de la enfermedad cardiovascular (Shekelle et al 2004) y algunos
tipos de cáncer (Pham and Plakogiannis 2005). Debido a su naturaleza lipofílica posee un
importante papel en el mantenimiento de la estabilidad de las membranas celulares así
como en la prevención de la oxidación de las LDL (Upston et al 2001). La vitamina C (VC)
tiene un elevado poder para neutralizar los radicales libres protegiendo a las diferentes
estructuras del daño oxidativo, además posee la capacidad de restaurar el poder
antioxidante de la vitamina E en interacción con el selenio (May 2000). La vitamina A
posee al igual que la vitamina E naturaleza lipofílica y se ha comprobado su papel
protector sobre los daños por estrés oxidativo del DNA y la peroxidación lipídica (Kris‐
Etherton et al 2004).
Respecto a los otros dos grupos los principales minerales considerados antioxidantes
son el manganeso, el zinc y el cobre por su papel como cofactores de las dos isoformas
de la Sod. El zinc además desarrolla un papel protector frente al ataque de los radicales
a compuestos con grupos tioles como el GSH (Hao and Maret 2005). En cuanto al papel
del selenio como antioxidante se centra principalmente en actuar como cofactor de la
Gpx (Faure 2003) y en su actividad como potenciador de la vitamina E (Wintergerst,
Maggini and Hornig 2007).
Chapter 1 Introduction Capítulo 1 Introducción
71
Entre otras sustancias antioxidantes analizadas en recientes estudios cabe destacar el
papel del ácido lipoico (AL) en la reducción de los peróxidos lipídicos, la neutralización
de radicales libres así como su capacidad para regenerar el poder antioxidante de las
vitaminas C y E endogenamente (Moini, Packer and Saris 2002). El resveratrol (RSV)
posee un elevado poder antioxidante actuando sobre diferentes puntos de la CTE (de la
Lastra and Villegas 2007), principalmente como competidor del CoQ, disminuyendo la
producción de ROS, neutralizando el O2*‐ e inhibiendo la peroxidación lipídica (Zini et al
1999). Por último, resaltar el papel de diferentes compuestos fenólicos presentes en
infusiones y extractos naturales cuyo elevado poder antioxidante se ha evidenciado en
diferentes estudios, aunque no se conoce con certeza el mecanismo por el cual lo llevan
a cabo. Algunos ejemplos de estos compuestos son las catequinas presentes en el té
verde (Mandel et al 2005), las antocianinas (Zafra‐Stone et al 2007) y otros compuestos
fenólicos (Soobrattee, Bahorun and Aruoma 2006).
1.4 LA MITOCONDRIA
1.4.1 ESTRUCTURA
Las mitocondrias son los orgánulos responsables de la mayoría de los procesos
metabólicos relacionados con la obtención y transformación de la energía, su tamaño
oscila entre 0,5 y 1 µm de diámetro y hasta 7 µm de longitud y su número varía en
función de las necesidades energéticas de la célula. Estas estructuras se encuentran
rodeadas por un sistema de doble membrana, constituido por una membrana
mitocondrial interna y otra externa separadas por un espacio intermembrana. La
membrana interna se caracteriza por la presencia de una serie de invaginaciones
denominadas crestas (Alberts B. 1989, Smoly, Kuylenstierna and Ernster 1970)
(Ilustración 12), cuya ventaja principal es el aumento de la superficie total de la
membrana interna.
Capítulo 1 Introducción Chapter 1 Introduction
72
Ilustración 12 Esquema de la estructura mitocondrial (A) y micrografía electrónica
coloreada de mitocondrias de células hepáticas (9400 aumentos a 4x5 cm de tamaño)
La matriz y la membrana interna constituyen los principales compartimentos funcionales
de la mitocondria. A continuación explicaremos brevemente todos los compartimentos
mitocondriales:
Membrana externa: está constituida por una bicapa lipídica permeable a todas las
moléculas con un tamaño menor a 5000 daltons (iones, metabolitos y gran número de
polipéptidos), debido al elevado número de porinas que forman canales acuosos dentro
de la membrana externa.
Espacio intermembrana: está compuesto de un líquido similar al hialoplasma y
contiene una alta concentración de protones como resultado del bombeo de los mismos
por los complejos enzimáticos de la cadena respiratoria. En él se localizan diversos
enzimas como la adenilato quinasa o la creatina quinasa.
Membrana interna: también está constituida por una bicapa lipídica que contiene un
elevado contenido en cardiolipina que confiere a la membrana una elevada
impermeabilidad a los iones (Ott, Zhivotovsky and Orrenius 2007), lo que hace que sea
altamente selectiva siendo solamente permeable al O2, H2O y CO2. Por otro lado, posee
numerosas proteínas transportadoras para diferentes metabolitos. Este control de la
Chapter 1 Introduction Capítulo 1 Introducción
73
permeabilidad permite la generación de gradientes iónicos que produce la separación
de las funciones metabólicas entre el citosol y la mitocondria.
Asimismo, en la membrana interna mitocondrial se encuentran una serie de enzimas
como las de la cadena respiratoria que se caracterizan por la cohesión física de sus
distintos componentes y son esenciales para el proceso de fosforilación oxidativa. Por
otro lado, en la superficie interna de la membrana se localizan una serie de esferas
constituidas por la enzima F1‐ATPasa, responsable de la síntesis de ATP, proceso que en
situaciones normales se encuentra acoplado a la cadena respiratoria (Scheffler 2008c).
Matriz mitocondrial: está constituida por una sustancia tipo gel en la que existen
elevadas concentraciones de enzimas disueltas. Principalmente contiene las enzimas
solubles del ciclo de los ácidos tricarboxílicos, la glutamato deshidrogenasa y las enzimas
de oxidación de ácidos grasos (Ernster 1970).
1.4.2 VÍAS METABÓLICAS EN LA MITOCONDRIA: CICLO DE KREBS Y METABOLISMO DE
ÁCIDOS GRASOS
La fuente principal de energía metabólica en las células animales es la degradación
oxidativa de la glucosa y los ácidos grasos cuyas etapas finales se desarrollan en la matriz
mitocondrial (Ilustración 13):
Ilustración 13 Etapas finales de los procesos catabólicos que se desarrollan en la matriz
mitocondrial. Adaptado de Rogge, M (2009)
Capítulo 1 Introducción Chapter 1 Introduction
74
Como se observa en la ilustración las etapas iniciales del metabolismo oxidativo de la
glucosa se desarrollan en el citoplasma donde la glucosa es convertida en piruvato a
través del proceso de glucólisis. El piruvato es transportado a la matriz mitocondrial
desde el espacio intermembrana mediante transporte activo. Posteriormente se
produce un proceso de decarboxilación oxidativa del piruvato a acetil coenzima A
(AcCoA) por la piruvato deshidrogenasa (PDH). El AcCoA es oxidado completamente a
CO2 a través del ciclo de Krebs (CK). Esta oxidación se encuentra acoplada a la reducción
de NAD+ y FAD a NADH y FADH2, respectivamente, que pasan a la CTE. Dentro del Ciclo
de Krebs existen dos enzimas de especial importancia:
Citrato sintasa (CS): la importancia de esta enzima radica en el papel que ejerce
como uno de los principales controladores de la actividad del CK ya que regula la
condensación de oxalacetato (OAA) con AcCoA proveniente de la glucólisis
siendo este uno de los pasos irreversibles del CK (Remington 1992, Wiegand and
Remington 1986). La actividad CS esta inhibida por altos ratios entre ATP:ADP o
NADH:NAD; además elevadas concentraciones de ATP y de AcCoA actúan como
moduladores alóstericos negativos (Beard, Vinnakota and Wu 2008, Chepelev et
al 2009). Por otro lado, la relación entre la actividad CS en el tejido total y en
extractos mitocondriales se ha utilizado en numerosos estudios como medida
indirecta de la masa mitocondrial de un tejido (Crescenzo et al 2006, Raffaella et
al 2008, Renner et al 2003).
Succinato Deshidrogenasa (SDH) o Complejo II: la SDH cataliza la transformación
de succinato a fumarato empleando el poder reductor generado par la
transformación de FAD a FADH2. La importancia de esta enzima radica en su
doble papel como enzima del Ciclo de Krebs y como complejo de la cadena de
transporte de electrones lo que nos permite analizarla desde ambos puntos de
vista, asimismo es la única enzima que participa en el CK que no se encuentra en
suspensión en la matriz mitocondrial sino que se encuentra anclada a la
membrana interna del orgánulo (Rustin, Munnich and Rotig 2002, Rutter, Winge
and Schiffman 2010). Por otro lado, recientemente se ha descrito que su
actividad se encuentra regulada por procesos de acetilación siendo una diana
específica de la Sirt3 (Cimen et al 2010, Finley et al 2011).
Chapter 1 Introduction Capítulo 1 Introducción
75
Por otro lado, los ácidos grasos son transformados en derivados acil CoA que son
transportados al interior de la matriz a través de la Cpt1. En la matriz sufren diferentes
ciclos de ß‐Oxidación hasta AcCoA, produciéndose en dichos ciclos moléculas de FADH2.
Así como en el caso del metabolismo oxidativo mitocondrial de la glucosa en el proceso
de transporte y ß‐Oxidación de los ácidos grasos nos gustaría recalcar la importancia de
dos enzimas implicadas en ellos:
Carnitina palmitoiltransferasa 1: el sistema enzimático carnitina
palmitoiltransferasa cataliza la activación necesaria de los acidos grasos de
cadena larga, como el ác. Palmítico, para ser transportados a la matriz
mitocondrial y allí entrar en la ß‐Oxidación, este transporte es necesario ya que
la membrana mitocondrial interna es impermeable a estos ácidos grasos
(Ramsay, Gandour and van der Leij 2001). La Cpt1 es la primera enzima
componente de este proceso y su actividad limita el funcionamiento de este
sistema y la ß‐Oxidación (Jogl and Tong 2003, Bonnefont et al 2004).
Acil‐Coenzima A deshidrogenasa, cadena larga (Acadl): esta enzima interviene
en la primera de las reacciones de la ß‐Oxidación. Se encuentra en la matriz
mitocondrial y su actividad se considera como otro de los pasos limitantes de la
oxidación de ácidos grasos (Houten and Wanders 2010, Lea et al 2000). En
cuanto a su regulación, Hirschey et al (2010) describieron que su actividad era
regulada por reacciones de desacetilación mediadas por la Sirt3 y que el control
de esta enzima regulaba la actividad de la ß‐Oxidación (Hirschey et al 2010).
Por tanto, el intermediario central del metabolismo oxidativo tanto de los azúcares
como de los ácidos grasos en las mitocondrias es el AcCoA.
Por último, la degradación de aminoácidos se desarrolla principalmente en el citosol,
aunque determinados aminoácidos pueden ser transportados a la matriz mitocondrial
por diversos transportadores activos específicos, donde son transformados en cuerpos
cetónicos por acción de diferentes transaminasas (Rogge 2009, Scheffler 2008b,
Williamson and Cooper 1980).
Capítulo 1 Introducción Chapter 1 Introduction
76
1.4.3 CADENA DE TRANSPORTE DE ELECTRONES
La misión de la cadena transportadora de electrones es aprovechar la energía
desprendida por la transferencia de electrones desde el NADH al O2 para crear un
gradiente electroquímico que se utilice en la síntesis de ATP (Kadenbach et al 2010,
Mitchell 1961). Para ello es necesario que la transferencia electrónica se realice de
forma gradual mediante el paso de los electrones entre los diferentes transportadores
que son capaces de experimentar cambios reversibles en su estado redox (Dimauro and
Rustin 2009). Estos transportadores están organizados en cuatro complejos anclados en
la membrana interna mitocondrial con un ordenamiento secuencial que facilita la
transferencia de electrones y promueve una alta eficiencia del sistema. Un quinto
complejo de proteínas sirve para acoplar las reacciones de transporte de electrones a la
síntesis de ATP (Kerr 2010, Rich and Marechal 2010).
Ilustración 14 Esquema de la cadena de transporte de electrones y balance de protones
Chapter 1 Introduction Capítulo 1 Introducción
77
1.4.3.1 Complejo I (NADH deshidrogenasa)
Es el complejo proteico más grande de la membrana mitocondrial interna, consta de 43
subunidades, siete de ellas codificadas por el propio genóma mitocondrial. Contiene
como grupo prostético una molécula de flavina mononucleótido y siete agrupamientos
hierro‐azufre (Fe‐S) (Valsecchi et al 2010). En él se inicia la trasferencia electrónica de la
cadena respiratoria mediante la oxidación del NADH, que transfiere sus electrones a la
flavina mononucleótido y ésta, a su vez, a los agrupamientos Fe‐S que acaban
donándolos al CoQ, que actúa como aceptor final (Brandt 2006, Koopman et al 2010).
Este complejo genera aproximadamente el 40% del gradiente electroquímico de la
oxidación del NADH a través del bombeo de protones al espacio intermembrana (Lenaz
et al 2006, Vinogradov 2008).
1.4.3.2 Complejo II
Este complejo contiene a la enzima SDH junto con otras tres subunidades de bajo peso
molecular. Químicamente está compuesto por una molécula de flavin adenin
mononucleótido (FAD) unida covalentemente, ocho átomos de hierro, ocho de azufre
lábiles a los ácidos y un citocromo b460. Esta estructura le permite participar en el ciclo
de los ácidos tricarboxílicos y en la cadena respiratoria (Rustin, Munnich and Rotig 2002,
Rutter, Winge and Schiffman 2010). La molécula de FAD es el aceptor de electrones de la
reacción reduciéndose a FADH2 debido a la oxidación del Succinato ya que esta reacción
de oxidación no produce suficiente poder reductor para reducir el NAD+ a NADH. El
FADH2, al estar unido covalentemente a la enzima, debe oxidarse in situ cediendo sus
dos hidrógenos al CoQ, que se reduce a ubiquinol (QH2), que es móvil y difunde por la
bicapa hasta el complejo III (Yankovskaya et al 2003).
1.4.3.3 Complejo III (Citocromo C oxidoreductasa)
El complejo III está formado por cuatro cofactores redox; un citocoromo b situado en el
espacio transmembrana y orientado hacia el espacio intermembrana, un citocromo c
(Cit c) y un agrupamiento de dos átomos de hierro y dos de azufre. Los citocromos son
proteínas encargadas de la transferencia de electrones mediante un átomo de Fe2+
situado en un grupo prostético hemo (Scheffler 2008c). El complejo III obtiene dos
electrones desde QH2 y los transfiere al Cit c, al mismo tiempo, transloca dos protones a
Capítulo 1 Introducción Chapter 1 Introduction
78
través de la membrana contribuyendo a la generación del gradiente electroquímico (Gao
et al 2003). Este complejo junto con el Complejo I es la fuente más importante de
producción de ROS (Malinska et al 2010, Viola and Hool 2010, Zhang, Zhang and Zhang
2011) y por otro lado se ha descrito su papel como un sensor de los niveles de oxígeno
intracelulares (Chandel 2010).
1.4.3.4 Complejo IV (Citocromo c oxidasa)
Es la enzima terminal de la cadena de transporte de electrones. Está formada por
aproximadamente 14 cadenas polipeptídicas, todas ellas codificadas por el mtDNA
(Mick, Fox and Rehling 2011), de las cuales la subunidad I y la II son necesarias para la
transferencia de electrones y se encuentran situadas en la membrana interna
mitocondrial en forma de dímero formando múltiples hélices que la atraviesan. Estas
dos subunidades contienen cuatro centros redox activos, dos hemo de tipo a y dos
centros cobre, el resto de las cadenas polipeptídicas parecen tener un papel regulador
sobre ambas subunidades (Brzezinski, Reimann and Adelroth 2008, Tsukihara et al
1995). Este complejo es el encargado de catalizar las oxidaciones de un electrón de las
cuatro moléculas de Cit c reducido y la reducción simultanea de cuatro electrones de
una molécula de O2 para producir H2O. Al mismo tiempo se produce una traslocación de
cuatro protones al espacio intermembrana (Yoshikawa, Muramoto and Shinzawa‐Itoh
2011a, Yoshikawa, Muramoto and Shinzawa‐Itoh 2011b) y la participación en la
formación de ROS (Yu et al 2011, Kadenbach, Ramzan and Vogt 2009).
1.4.3.5 Complejo V (ATP sintasa)
Es el quinto complejo que interviene en la fosforilación oxidativa y se halla acoplado a la
cadena de transporte electrónico, si bien, no forma parte de ella. Está constituida por
dos componentes estructuralmente diferentes, F0 y F1, que se encuentran unidos a
través de un tallo (Abrahams et al 1994, Rubinstein, Walker and Henderson 2003). El
componente F0 atraviesa la membrana interna constituyendo un canal para el paso de
los protones desde el espacio intermembrana a la matriz, este retorno es
energéticamente favorable y se encuentra acoplado a la síntesis de ATP (Dickson et al
2006, Silvester et al 2006, Walker and Dickson 2006). La porción F1 es la que cataliza la
síntesis de ATP a partir de ADP e iones fosfato (Seelert and Dencher 2011, Wittig and
Schagger 2009). Diferentes estudios han establecido que la síntesis del ATP requiere de
Chapter 1 Introduction Capítulo 1 Introducción
79
un acoplamiento mecánico entre ambas subunidades y un mecanismo de rotación
específico (Maguire, Shah and McCabe 2006, Nakamoto, Baylis Scanlon and Al‐Shawi
2008). Por otro lado, la ATP sintasa puede actuar en sentido reverso, es decir hidrolizar
el ATP a ADP y fosfato en ausencia del gradiente electroquímico de protones (Feniouk,
Suzuki and Yoshida 2007, Lotscher, deJong and Capaldi 1984).
1.4.4 LA FOSFORILACIÓN OXIDATIVA
La fosforilación oxidativa está constituida por dos procesos principalmente:
La transferencia de electrones desde NADH y FADH2 hasta el oxígeno molecular,
que se da a través de la cadena de transporte de electrones.
El acoplamiento de este proceso con la síntesis de ATP.
El mecanismo de acoplamiento de ambos procesos es también denominado
acoplamiento quimiostático y se basa en la hipótesis propuesta por Peter Mitchell en
1961 (Mitchell 1961), en la que sugirió que el ATP se genera utilizando la energía
almacenada en forma de un gradiente de protones a través de las membranas
biológicas.
Como se ha descrito anteriormente, el transporte de electrones a través de los
complejos de la CTE esta acoplado a una translocación de protones al espacio
intermembrana, estableciéndose a si un gradiente de protones a través de la membrana
interna (Nath 2010b, Nath 2010a). Este bombeo produce un aumento en la
concentración de los mismos en el espacio intermembrana, que se traduce en un
aumento de una unidad de pH en la matriz mitocondrial (pH=8), esta diferencia de pH
genera un potencial eléctrico a través de la membrana (Dimroth, Kaim and Matthey
2000, Huttemann et al 2008). Ambos fenómenos, el gradiente de protones y el potencial
eléctrico, dirigen el flujo de protones desde el espacio intermembrana a la matriz.
Debido a que la bicapalipídica es altamente impermeable a los iones por su elevado
contenido en cardiolipina, los protones solo pueden atravesar la membrana por un canal
de proteínas (Klingenberg 2009, Schlame and Ren 2009), permitiendo esta restricción el
aprovechamiento de la energía del gradiente electroquímico para la formación de ATP
por la ATP sintasa.
Capítulo 1 Introducción Chapter 1 Introduction
80
Ilustración 15 Esquema del flujo de protones en la fosforilación oxidativa
Por otro lado, las reacción de oxidación y de formación de ATP en la mitocondria
depende de la presencia de ADP y de fosforo inorgánico. En condiciones fisiológicas la
membrana mitocondrial tiene una elevada concentración de fósforo inorgánico siendo
la concentración de ADP la reguladora de la velocidad de los procesos respiratorios
mitocondriales (D'Alessandro and Melandri 2010, Jeneson et al 2009). La medida del
consumo de oxígeno por diferentes métodos, como la polarografía de oxígeno
(Gadhinglajkar, Sreedhar and Unnikrishnan 2009), permite determinar la existencia de
diferentes estados respiratorios. Así, el estado metabólico caracterizado por la presencia
de substratos oxidables, como el succinato, pero en ausencia de ADP es el denominado
estado 2 y se caracteriza por un consumo lento de oxígeno. La adición de ADP determina
un aumento en la velocidad de consumo de oxígeno hasta diez veces mayor, este estado
respiratorio es el estado 3 y corresponde a la fase de formación de ATP, y se mantiene
hasta que se produce un agotamiento del substrato estableciéndose el estado 4, que se
caracteriza por un bajo consumo de oxígeno (Chance and Williams 1955, Estabrook
1967, Gnaiger 2009, Lemieux et al 2011) (Ilustración 16).
Chapter 1 Introduction Capítulo 1 Introducción
81
Ilustración 16 Consumo de oxígeno en los diferentes estados respiratorios (gráfica
obtenida en un oxígrafo). Adaptada de Curti et al (1999)
La relación entre el consumo de oxígeno en los estados 3 y 4 (estado 3/estado 4) se
denomina ratio de control respiratorio (RCR) y se considera una medida indirecta del
acoplamiento entre los procesos de oxidación y fosforilación, así como de la integridad
mitocondrial (Voet 2006, Roussel et al 2004). Otra relación que se utiliza
frecuentemente para evaluar estos parámetros y también la eficiencia de la fosforilación
oxidativa es el ratio P/O, que corresponde a los nanomoles de oxígeno que necesita
consumir la CTE para fosforilar un nanomol de ADP (Hinkle 2005, Ferguson 2010).
Capítulo 1 Introducción Chapter 1 Introduction
82
1.4.5 BIOGÉNESIS MITOCONDRIAL
La expresión “biogénesis mitocondrial” se refiere a una serie de procesos celulares
involucrados en la formación de nuevas mitocondrias. El proceso de síntesis se
caracteriza por una serie de rápidos acontecimientos altamente coordinados entre
núcleo, el citoplasma y la mitocondria. En el fenómeno de biogénesis mitocondrial
confluyen dos procesos íntimamente ligados; la proliferación, que consiste en el
aumento del número de mitocondrias por célula; y la diferenciación, mediante la cual el
orgánulo adquiere las características estructurales y funcionales adecuadas para el
desarrollo de las funciones específicas de las distintas células del organismo (Nisoli et al
2004).
1.4.5.1 El genóma mitocondrial
La estructura, el contenido genético y la organización del genóma mitocondrial están
muy conservados en las distintas especies de mamíferos (Anderson et al 1981, Clay
Montier, Deng and Bai 2009, St John et al 2010). El mtDNA es un DNA circular de doble
cadena, de aproximadamente 16500 pares de bases y es poliploide (Hunter et al 2010,
Miller et al 2003), en concreto cada mitocondria puede contener un número variable de
copias que oscila entre 2 y 10.
Cada una de las hebras del mtDNA tiene una composición distinta de nucleótidos
guanina y timina, y son denominadas hebra pesada y hebra ligera. El mtDNA de
mamíferos codifica para 37 genes: 2 RNA ribosómicos (rRNAs), 22 RNA de transferencia
(tRNAs) y 13 polipéptidos integrantes de los complejos multienzimáticos del sistema
OXPHOS; siete (ND1, 2, 3, 4L, 4, 5 y 6) de los 46 polipéptidos del complejo I; uno (cytb)
de los 11 polipéptidos del complejo III; tres (citocromo c oxidasa I, II y III (COXI, II, III)) de
los 13 del complejo IV; y dos (ATP6 y 8) de los 16 de la ATP sintasa. Estos genes se
encuentran distribuidos de forma asimétrica entre las dos hebras, así la hebra pesada
contiene la mayoría de ellos salvo ocho tRNA y los mRNA (Legros et al 2004, Lanave et al
2002, Anderson et al 1981).
Chapter 1 Introduction Capítulo 1 Introducción
83
Ilustración 17 Mapa del genóma mitocondrial en vertebrados
1.4.5.2 Biogénesis mitocondrial: cooperación del genóma mitocondrial y nuclear
La transcripción del genóma mitocondrial está sometida a una fina regulación y su
expresión está coordinada con la de proteínas mitocondriales codificadas en el núcleo
(Hock and Kralli 2009, Ljubicic et al 2010, Scarpulla 2008b, Scarpulla 2011). Por esto la
biogénesis mitocondrial se regula coordinadamente por una serie de factores de
transcripción, codificados por genes nucleares. Estos factores de transcripción se
pueden dividir en tres grupos:
La primera clase incluye factores codificados por el núcleo que dirigen la expresión de
genes respiratorios nucleares. Entre ellos encontramos el factor respiratorio nuclear 1
(Nrf1), y el receptor relacionado con los estrógenos α (ERRα).
La segunda clase está compuesta por coactivadores, que forman complejos con los
factores de transcripción y facilitan la remodelación de la cromatina. En este grupo los
más importantes son los de la familia de los coactivadores de los Ppar: el coactivador 1 α
Capítulo 1 Introducción Chapter 1 Introduction
84
activado por proliferadores peroxisomales γ (Pgc1α) y el coactivador 1 β activado por
proliferadores peroxisomales (Pgc1β).
La tercera clase incluye diversos factores de transcripción de codificación nuclear que
promueven la expresión de genes mitocondriales. Estos incluyen el factor de
transcripción‐A mitocondrial (Tfam), el factor de transcripción mitocondrial B1 (Tfb1m) y
el factor de transcripción mitocondrial B1 (Tfb2m), la proteína de unión a DNA de hebra
única, y un factor de terminación de la transcripción. Todos los anteriores tienen la
capacidad de regular la actividad de la RNA gamma‐polimerasa.
1.4.5.3 Transcripción del mtDNA
El genóma mitocondrial, a diferencia del nuclear, se transcribe de forma completa a
partir de los promotores de transcripción de la cadena pesada y ligera, generando en el
proceso dos mRNA, uno por cada hebra (Scheffler 2008a). La iniciación de la
transcripción requiere la actividad de, al menos, una RNA polimerasa específica de
orgánulo (Ringel et al 2011), el Tfam (Fisher et al 1991, Clayton 1991, Clayton 1992) y el
Tfb1m y Tfb2m (Falkenberg et al 2002, Gleyzer, Vercauteren and Scarpulla 2005).
El Tfam forma parte de la familia de proteínas de alta movilidad y posee la capacidad de
unirse al mtDNA, de discriminar entre secuencias específicas y no específicas y de
modificar su estructura tridimensional, facilitando de esta forma la unión de la RNA
polimerasa al punto de iniciación de la transcripción (Shadel and Clayton 1997, Parisi
and Clayton 1991, Fisher et al 1991). El Tfam es capaz de iniciar la transcripción tanto in
vivo como in vitro (Falkenberg, Larsson and Gustafsson 2007) y muestra una afinidad
muy distinta por los promotores de transcripción del mtDNA situados en el D‐loop. Sin
embargo, aún existe cierta controversia acerca del papel del Tfam en la fisiología
mitocondrial y celular; ya que además de su potencial participación en la regulación de
la transcripción, también ha sido relacionado con el mantenimiento de la estructura, el
grado de empaquetamiento y el control del número de copias de mtDNA en la
mitocondria(Kanki et al 2004a, Kanki et al 2004b, Zhang et al 2011a), además de una
posible conexión con los procesos de apoptosis(Yoshida et al 2003).
Chapter 1 Introduction Capítulo 1 Introducción
85
1.4.5.4 Regulación de la biogénesis a nivel nuclear
Diferentes mecanismos de señalización promueven la activación de los factores de
transcripción involucrados en la biogénesis mitocondrial, convergiendo la mayoría de
ellos en la regulación del promotor de Pgc1α o de Pgc1α (Fernandez‐Marcos and
Auwerx 2011, Hock and Kralli 2009, Scarpulla 2011). Las principales vías son
dependiente de la ruta de las quinasas activadas por mitógenos (MAPK) (Puigserver et al
2001, Tedesco et al 2010), de ciclinas (Wang et al 2006, Sakamaki et al 2006), de las
quinasas activadas por AMP (AMPK) (Jager et al 2007, Rohas et al 2007) o la activación
de Crebp, entre otras. De especial importancia para esta tesis es la regulación de la
biogénesis mitocondrial por estrés oxidativo (Costa et al 2011), así como por las sirtuinas
1 y 3 como describiremos más adelante (Aquilano et al 2010, Kong et al 2010).
Ilustración 18 Señales de regulación de la biogénesis mitocondrial que confluyen en el
promotor de Pgc1α o en Pgc1α. La parte superior de la figura muestra los sitios de
regulación del promotor y sitios de unión al DNA. La parte inferior de la figura muestra la
regulación y activación de Pgc1α. En flechas negras se muestran las señales de activación y
en barras rojas las señales de inhibición. Adaptado de Hock et al (2009)
Capítulo 1 Introducción Chapter 1 Introduction
86
Los factores de respiración nucleares 1 y 2 (Nrf1 y Nrf2) son unos de los factores de
transcripción implicados en la regulación de la función respiratoria y de la biogénesis
mitocondrial (Scarpulla 2008a, Vercauteren, Gleyzer and Scarpulla 2008). En particular
Nrf1 fue el primer factor nuclear en describirse como regulador positivo de la
transcipción de genes que codifican para Cit c (Herzig, Andersson and Scarpulla 2000) y
Cit c oxidasa (COX) (Ongwijitwat and Wong‐Riley 2004, Wong‐Riley et al 2005). A su vez
tiene un papel en la síntesis de ATP mediante la regulación de la expresión de la
subunidad α y γ de la ATP sintasa (Shao et al 2010, Chau, Evans and Scarpulla 1992).
Además, diversos estudios de inmunoprecipitación de cromatina in vivo demuestran que
el Nrf1 actúa sobre el control de la maquinaria de transcripción y el mantenimiento del
mtDNA mediante la regulación de Tfam (Liu et al 2007, Taherzadeh‐Fard et al 2011,
Piantadosi and Suliman 2006) y de Tfb1m y Tfb2m (Gleyzer, Vercauteren and Scarpulla
2005, Vercauteren, Gleyzer and Scarpulla 2008).
En cuanto a la regulación de este factor, se ha descrito que a nivel transcripcional la
restricción calórica (Civitarese et al 2007, Civitarese, Smith and Ravussin 2007,
Spiegelman 2007) y el ejercicio físico (Vina et al 2009, Daussin et al 2011) aumentan su
expresión. Por otro lado, el Nrf1 está rápida y eficazmente regulado por translocación
nuclear y modificación post‐transduccional principalmente por el déficit energético
(Bergeron et al 2001, Nisoli et al 2005) y el estrés oxidativo (Angeloni et al 2011, Biswas
and Chan 2010) mediante la activación de las MAPK.
1.4.5.5 Co‐activadores de la biogénesis mitocondrial: Pgc1α y Pgc1β
El Pgc1α fue el primer miembro en descubrirse de una familia de co‐activadores
transcripcionales que tienen una importante función integradora en la regulación de la
biogénesis mitocondrial en variadas situaciones fisiológicas. Así, la expresión de Pgc1α
es muy elevada en tejidos con sistemas mitocondriales muy desarrollados (Puigserver
2005). Por otro lado, su expresión se induce en situaciones fisiológicas que aumentan la
demanda mitocondrial para producir energía en forma de ATP o calor, como son la
exposición al frío en el TAM (TAM) (Hao et al 2010), el ejercicio físico en el músculo
(Calvo et al 2008, Lin et al 2002) o el ayuno en el hígado (Cao et al 2004, Herzig et al
2001).
Chapter 1 Introduction Capítulo 1 Introducción
87
A nivel molecular, el Pgc1α modula la biogénesis mitocondrial a través de su interacción
con diferentes factores de transcripción. En particular, tiene la capacidad de co‐activar la
actividad transcripcional de Nrf1, e inducir a su vez la expresión del Nrf1, del Nrf2 y del
Tfam (Fernandez‐Marcos and Auwerx 2011). Además, puede interaccionar con
miembros de la superfamilia de receptores nucleares, como el Pparγ (Vercauteren,
Gleyzer and Scarpulla 2008), el receptor de glucocorticoides (Knutti, Kaul and Kralli
2000) y el receptor de estrógenos (Dufour et al 2007, Mootha et al 2004, Schreiber et al
2004). A nivel post‐transcripcional, Pgc1α se encuentra regulado por situaciones de
estrés energético que activan tanto la vía de la AMPK como la Sirt1 (Canto and Auwerx
2009, Canto et al 2009, Iwabu et al 2010, Rodgers et al 2008).
Ilustración 19 Red de regulación de la función mitocondrial dirigida por Pgc1α. Adaptado
de Scarpulla et al (Scarpulla 2011)
Capítulo 1 Introducción Chapter 1 Introduction
88
El Pgc1β es otro de los principales co‐activadores de la biogénesis mitocondrial
perteneciente a la familia de Pgc1α. Entre ambos co‐activadores existen importantes
similitudes en la secuencia de ácidos nucleicos y a nivel de proteína, tanto en el dominio
de activación amino‐terminal como en el carboxi‐terminal (Lin et al 2002, Monsalve et al
2000). Ambos co‐activadores se expresan abundantemente en tejidos con un elevado
contenido en mitocondrias como el corazón, músculo, TAM o hígado, sin embargo Pgc1β
no se induce en el TAM como respuesta termogénica (Kressler et al 2002, Meirhaeghe et
al 2003).
Aunque inicialmente se pensó que estaba implicado en la gluconeogénesis hepática (Lin
et al 2002), el Pgc1β tiene escasa capacidad de estimular la expresión de genes
gluconeogénicos en hepatocitos y en hígado (Lelliott et al 2007, Lin et al 2003,
Meirhaeghe et al 2003). Algunos autores han sugerido que estas diferencias se deben a
la falta de interacción con el factor nuclear hepatocitario 4 α (HNF‐4) y con el factor de
transcripción forkhead 1 (Foxo1) por parte de Pgc1β (Meirhaeghe et al 2003, Scarpulla
2011), responsables de la expresión de genes gluconeogénicos. Sin embargo, Pgc1β
actúa como potente coactivador de Nrf1 promoviendo la transcripción de genes
mitocondriales implicados en la regulación de la biogénesis mitocondrial (Scarpulla
2008a, Shao et al 2010, Gao et al 2011a, Gao et al 2011b).
A pesar de las similitudes funcionales entre ambos coactivadores, Pgc1β promueve un
mayor acoplamiento en la respiración mitocondrial que puede estar relacionado con
cambios en la eficiencia energética (Handschin and Spiegelman 2006, St‐Pierre et al
2003). Por otro lado, algunos estudios han descrito la capacidad de Pgc1β para
aumentar la oxidación de ácidos grasos a nivel hepático (Staiger et al 2006, Wolfrum and
Stoffel 2006). En cuanto a la regulación post‐transcripcional de Pgc1β existen pocos
datos pero algunos autores sugieren que debido a las similitudes con Pgc1α pueda ser
regulado por procesos de desacetilación mediados por sirtuinas (Kelly et al 2009).
Chapter 1 Introduction Capítulo 1 Introducción
89
1.4.6 LA MITOCONDRIA COMO FUENTE, DIANA Y PROTECCIÓN DEL ESTRÉS OXIDATIVO
La mitocondria es la principal fuente de estrés oxidativo del organismo, ya que se estima
que es responsable de la producción del 80% de ROS del organismo (Andreyev,
Kushnareva and Starkov 2005). De hecho, se ha sugerido que el oxígeno utilizado para la
producción de ROS en la mitocondria corresponde a 1‐2% del total que está involucrado
en la respiración celular, aunque depende del estado metabólico mitocondrial y del
tejido (Alvarez 2000, Barja 2007).
El papel de la mitocondria como fuente de ROS fue descrito por primera vez en 1966 por
Jensen et al (Jensen 1966), que formularon la hipótesis de que la cadena de transporte
de electrones produjera H2O2. Posteriormente, Boveris et al describieron las
propiedades de esta producción en mitocondrias aisladas de hígado de rata (Boveris,
Oshino and Chance 1972). En relación a la producción de O2*‐ en la mitocondria se
describió con posterioridad por Loschen et al (1974) (Loschen et al 1974) que estableció
que el O2*‐ era un precursor del H2O2 (Boveris and Cadenas 1975).
Las fuentes principales de ROS mitocondriales son los complejos I, II y III (Brand 2010,
Kowaltowski et al 2009, Murphy 2009), algunas enzimas del ciclo del ácido cítrico como
la α‐cetoglutarato deshidrogenasa (Orrenius, Gogvadze and Zhivotovsky 2007), la
priuvato deshidrogenasa (Miwa and Brand 2005), la dihidrolipoamida deshidrogenasa
(Murphy 2009), las monoaminoxidasa s(Bortolato, Chen and Shih 2008) y la citocromo
b5 reductasa (Lin and Beal 2006). Si bien, las que contribuyen en mayor medida al
desarrolló de estrés oxidativo son el complejo I y III (Ilustración 20) (Murphy 2009). Así,
la producción de O2*‐ en el complejo I se produce principalmente por la reacción del O2
con el grupo prostético FMN completamente reducido (Kussmaul and Hirst 2006), otro
mecanismo de producción de O2*‐ en este complejo es durante el transporte inverso de
electrones en la cadena respiratoria (Liu, Fiskum and Schubert 2002). En relación a la
formación de O2*‐ en el complejo III, esta se produce principalmente por la reacción del
O2 con la semiubiquinona en el llamado ciclo Q (Liu, Fiskum and Schubert 2002, Adam‐
Vizi 2005, Brand 2010, Selivanov et al 2011).
Capítulo 1 Introducción Chapter 1 Introduction
90
Ilustración 20 Producción de O2*‐ en la cadena de transporte de electrones. Tomada de
Browlee et al (2001)
La mitocondria no sólo es fuente de ROS sino que también desarrolla un importante
papel en la defensa frente al estrés oxidativo. Para ello consta con importantes defensas
antioxidantes (Ilustración 21) de naturaleza enzimática y no enzimática. Las defensas no
enzimáticas están constituidas por una serie de quelantes tanto de naturaleza hidrofílica
como lipofílica, entre los que destacas el Cit c, el α‐tocoferol, la VC, el CoQ reducido y el
glutatión (Addabbo, Montagnani and Goligorsky 2009). En cuanto a las defensas
enzimáticas, están formadas principalmente por la Sod2 que cataliza la transformación
del O2*‐ a H2O2 (Macmillan‐Crow and Crow 2011) y la Gpx mitocondrial (mtGpx)
principalmente en su isoforma dependiente de selenio, que cataliza la detoxificación del
H2O2 a H2O. Otra de las enzimas antioxidantes que puede contribuir a las defensas
antioxidantes mitocondriales es la catalasa, que fundamentalmente se expresa en el
compartimento mitocondrial del músculo cardíaco (Bai and Cederbaum 2001, Neubert
and Lehninger 1962, Radi et al 1991), aunque recientemente un estudio ha observado
actividad catalasa en extractos mitocondriales de hígado de rata en situaciones de
aumento del estrés oxidativo hepático (Salvi et al 2007). Otra enzima que contribuye de
forma indirecta en las defensas antioxidantes mitocondriales es la glutatión reductasa
Chapter 1 Introduction Capítulo 1 Introducción
91
(GR), que participa en la regeneración del glutatión reducido y la thioredoxin reductasa
(TRX) dependiente de NADH.
Ilustración 21 Principales defensas antioxidantes mitocondriales y vías de formación
de especies reactivas desde O2*‐. CAT; catalasa, Gpx ; glutatión peroxidasa, GSH;
glutatión reducido, GSSG; glutatión oxidado, GR; glutatión reductasa, MnSOD;
manganeso superóxido dismutasa Tomada de Valdecantos et al (2009)
Por otro lado, la mitocondria también es diana del estrés oxidativo debido a la reacción
de las ROS con las estructuras mitocondriales (Smith and Murphy 2011, Someya and
Prolla 2010, Vendelbo and Nair 2011). Así, el O2*‐ puede reaccionar con el mtDNA
causando mutaciones que lleven a defectos en la síntesis de las proteínas de los
complejos de la CTE lo cual puede originar una disfunción en su funcionamiento que a su
vez contribuye a una mayor producción de ROS (Ma et al 2009, Wei et al 2009). Por otro
lado, estas ROS también pueden producir una oxidación de los fosfolípidos de la
Capítulo 1 Introducción Chapter 1 Introduction
92
membrana interna produciéndose un aumento de la permeabilidad y del poro de
transición mitocondrial. Especialmente dañina es la reacción con la cardiolipina, ya que
induce la reducción de la afinidad de la misma con el Cit C produciéndose su liberación al
citosol lo cual desencadena la apoptosis por dependiente de la vía mitocondrial
(Klingenberg 2009, Ott, Zhivotovsky and Orrenius 2007) (Ilustración 22).
Ilustración 22 Esquema del daño oxidativo en la mitocondria. Cyt c; citocromo c, PTM;
poro de transición mitocondrial. Adaptada de Murphy (2009)
1.4.7 LAS SIRTUINAS COMO REGULADORES DE LA FUNCIÓN MITOCONDRIAL
1.4.7.1 Definición y clasificación de las sirtuinas
El Silent Information Regulator 2 (Sir2) de S. cerevisiae (Kaeberlein, McVey and Guarente
1999, Sinclair and Guarente 1997) fue el primer miembro de la familia de las
deacetilasas dependientes de NAD+ y ADP‐ribosiltransferasas, que se han denominado
sirtuinas (SIRTs)(Frye 1999). En mamíferos se han descrito siete proteínas
pertenecientes a la familia de las SIRTs (Ilustración 23). Las Sirt1 y 6 se localizan
fundamentalmente en el núcleo(Michan and Sinclair 2007, Herranz and Serrano 2010);
la Sirt7 en el nucléolo (Ford et al 2006); la Sirt2 en el citoplasma (North and Sinclair
Chapter 1 Introduction Capítulo 1 Introducción
93
2007) y las Sirt4 y 5 en la mitocondria(Verdin et al 2010, Huang et al 2010), finalmente la
Sirt3 se expresa principalmente en la mitocondria aunque dependiendo de diferentes
situaciones fisiológicas, como bajo condiciones de estrés energético, puede cambiar su
localización al núcleo o al citoplasma(Cooper et al 2009, Hallows, Albaugh and Denu
2008).
Ilustración 23 Localización celular de las diferentes sirtuinas. Adaptado de Alhazzazi et
al (2011)
Las SIRTs requieren como co‐factor metabólico NAD+ para ejercer su actividad
enzimática. Su domino catalítico, altamente conservado, puede ejercer dos tipos de
reacciones enzimáticas: la desacetilación y la ribosilación de ADP. Durante la reacción de
desacetilación, el NAD+ se hidroliza para generar nicotinamida (NAM), 2´‐O‐acetil‐ADP‐
ribosa (O‐AADPR) y una diana desacetilada (1) (Borra et al 2004). Hay dos mecanismos
de retroalimentación que regulan la actividad catalítica de las SIRTs. En primer lugar, la
NAM es un inhibidor de la enzima, ya que compite directamente con NAD+ por la unión
al dominio catalítico (2) (Zhang et al 2009, Sauve 2009). En segundo lugar, los niveles de
NAD+ controlan la actividad de las SIRTs (Sauve 2009). Los niveles de NAD+ y NADH están
regulados por varias enzimas y sus niveles están ligados a la concentración de nutrientes
suministrados por la dieta y al estado metabólico de la célula (Yang and Sauve 2006). La
enzima nicotinamida fosforibosiltransferasa (Nampt) utiliza la nicotinamida para
Capítulo 1 Introducción Chapter 1 Introduction
94
regenerar NAD+ y así promover la actividad de las SIRTs (3) (Yang and Sauve 2006). En
cambio, la poli‐ADP‐ribosa polimerasa (Parp), una proteína nuclear implicada en la
reparación del DNA, cataliza la reacción contraria; utiliza NAD+ para generar
nicotinamida y ADP‐ribosa (4) (Ilustración 24) (Jarrett and Boulton 2007, Orsucci,
Mancuso and Siciliano 2008).
PARP(4)
PNC 1 (levaduras)
Nampt(mamiferos)
Prot. Acetilada
Prot. Acetilada
Prot. Decetilada
Limitación de nutrientes
Estrés
Ilustración 24 Actividades enzimáticas de las SIRTs. Adaptado de Haigis et al (2010)
1.4.7.2 Sirtuina 1
La Sirt1 es una proteína predominantemente nuclear perteneciente a la familia de las
desacetilasas de histonas III (HDACs), está compuesta por 747 aminoácidos y un peso
molecular de aproximadamente 80KDa. La Sirt1 cataliza la reacción de desacetilación
sobre una gran variedad de substratos histonas así como de proteínas no histónicas
(Schug and Li 2011).
En relación a su actividad fisiológica, la Sirt1 estimula la biogénesis mitocondrial en
muchos tejidos como el músculo esquelético (Suwa et al 2011, D'Antona et al 2010), el
Chapter 1 Introduction Capítulo 1 Introducción
95
TAM (Feige et al 2008, Lagouge et al 2006) o en el hígado (Buler et al 2011), entre otros.
Múltiples estudios han descrito que la Sirt1 deacetila al co‐activador Pgc1α aumentando
su actividad transcripcional (Aquilano et al 2010, Brookins Danz et al 2009, Buler et al
2011, Danz et al 2009, Gerhart‐Hines et al 2007) y cambiando los sitios de acetilación a
arginina, lo cual mimetiza un mayor estado basal de desacetilación (Rodgers et al 2005).
La estimulación de Pgc1α induce una cascada de señalización que desemboca en un
aumento de la expresión de los genes implicados en la cadena de transporte de
electrones así como en un aumento de la respiración mitocondrial y de los niveles de
ATP. De hecho, recientemente Aquilano et al (2010) han descrito la presencia de Sirt1 y
Pgc1α asociado a los nucleoides mitocondriales en purificados de mitocondrias
formando un complejo con Tfam en hígado, cerebro y músculo esquelético además de
en líneas celulares, reafirmando la teoría de que la Sirt1 y el Pgc1α son el principal nexo
de unión entre el genóma nuclear y mitocondrial (Aquilano et al 2010).
Por otro lado, numerosas investigaciones han descrito a la Sirt1 como uno de los
principales sensores energéticos y reguladores metabólicos a través de su acción sobre
Pgc1α en numerosos tejidos (Buler et al 2011, Canto et al 2010, Erion et al 2009, Feige et
al 2008, Ruderman et al 2010). El tratamiento in vivo con agonistas de la Sirt1 promueve
la desacetilación de Pgc1α en músculo esquelético y TAM, lo que se traduce en un
aumento en la actividad mitocondrial así como un aumento en la termogénesis (Lagouge
et al 2006). Además, estos agonistas previenen el aumento de peso y la resistencia a la
insulina inducida por la ingesta de una dieta alta en grasa (Milne et al 2007). Por otro
lado, numerosos estudios han descrito que un aumento en la expresión y actividad de
Sirt1 en situaciones de restricción calórica su participación en el aumento de la
longevidad en diversos tejidos asociada a situaciones de restricción calórica (Cohen et al
2009, Chen et al 2005, Rogina and Helfand 2004, Bordone et al 2007).
Por otro lado, la Sirt1 es un importante regulador del metabolismo lipídico hepático
como se ha demostrado en numerosos estudios con animales transgénicos
(Purushotham et al 2009, Rodgers and Puigserver 2007). Así, como hemos descrito en el
punto anterior el ayuno prolongado aumenta la actividad de la Sirt1 y esta activa a
Pgc1α asi como a Pparα lo que produce un aumento en la oxidación de ácidos grasos y
una mejora en la homeostasis de la glucosa (Dominy et al 2010, Purushotham et al 2009,
Capítulo 1 Introducción Chapter 1 Introduction
96
Rodgers et al 2005). Otro posible mecanismo por el cual la Sirt1 controla el metabolismo
lipídico es a través de la desacetilación del factor de transcripción Srebp1 (sterol
regulatory element binding protein 1) como se ha descrito en diversas investigaciones
(Ponugoti et al 2010, Walker et al 2010). Otras dianas importantes de la actividad de
Sirt1 en el hígado es la represión de Foxo1 (Motta et al 2004) y el TORC2 (Liu et al 2008),
factores de transcripción relacionada con el control de los procesos desencadenados por
el ayuno de corta y larga duración (ilustración 25).
Ilustración 25 Efectos de la Sirt1 en el metabolismo del tejido hepático en situación de
ayuno. Los factores de transcripción activados por desacetilación se señalan con flechas
negras, los que se inhiben por la acción de la Sirt1 se muestran con barras negras. Adaptado
de Schung et al (2011)
1.4.7.3 Sirtuina 3
La Sirt3 humana se expresa como una proteína completa de 44 kDa que se expresa en la
mitocondria por la presencia de una secuencia de localización (Schwer et al 2002). En la
mitocondria, la Sirt3 es hidrolizada por una peptidasa de matriz mitocondrial (MPP) a
una isoforma de 28 KDa que posee una mayor actividad enzimática (Cooper et al 2009,
Schwer et al 2002). Sin embargo, diversos estudios han sugerido que ambas isoformas
Chapter 1 Introduction Capítulo 1 Introducción
97
son igualmente activas (Scher, Vaquero and Reinberg 2007) y aunque la mayoría de las
investigaciones apoyan la localización mitocondrial de la Sirt3 (Cooper et al 2009,
Lombard et al 2007, Schwer et al 2002), algunos han sugerido que puede estar presente
en el núcleo (Bao et al 2010, Scher, Vaquero and Reinberg 2007). En este sentido, un
estudio de Sundaresen et al describió que aunque la isoforma de 44 KDa se expresaba
en el nucleo, en el citoplasma y en la mitocondria, la isoforma de 28 KDa estaba
localizada principalmente en la mitocondria y en situaciones de estrés oxidativo los
niveles de ambas isoformas aumentaban en el núcleo y la mitocondria de cardiomiocitos
(Sundaresan et al 2008). Teniendo en cuenta esta controversia algunos autores
proponen que la Sirt3 ejerce sus funciones principalmente a nivel mitocondrial aunque
puede tener efectos en otros compartimentos celulares (Alhazzazi et al 2011, Hallows,
Albaugh and Denu 2008).
De hecho, numerosas investigaciones en los últimos años han descrito el papel de la
Sirt3 como principal responsable de la desacetilación de las proteínas mitocondriales
(Smith et al 2011, Hirschey et al 2010, Hirschey et al 2009, Lombard et al 2007) y su
papel como regulador de la homeostasis energétic a(Ahn et al 2008, Li and Kazgan 2011,
Shi et al 2005, Verdin et al 2010), el metabolismo lipídico a nivel mitocondrial
(Choudhury, Jonscher and Friedman 2011, Hallows et al 2011, Hirschey et al 2010) y la
biogénesis mitocondrial (Kong et al 2010).
De gran importancia para esta tesis son los estudios que han descrito el papel de la Sirt3
en la estimulación de las defensas antioxidantes mitocondriales (Kong et al 2010,
Lombard et al 2007, Someya et al 2010). Esta estimulación se debe principalmente a la
acetilación de tres dianas de la Sirt3: el factor de transcripción Forkhead 3a (Foxo3a), la
Isocitrato deshidrogenasa (IDH) y Sod2 (Ilustración 26). Respecto a la acción de la Sirt3
sobre Foxo3a, la desacetilación de este factor de transcripción aumenta su actividad
transcripcional produciendo una aumento en la expresión de genes implicados en las
defensas antioxidantes mitocondriales como la Sod2 o la catalasa como ha sido descrito
en estudios previos (Jacobs et al 2008, Kops et al 2002, Sundaresan et al 2009). Por otro
lado, Jacobs et al describieron una interacción física entre la Sirt3 y Foxo3a a nivel
mitocondrial que podría explicar algunos de los efectos de la Sirt3 en la mitocondria
(Jacobs et al 2008) (Ilustración 26).
Capítulo 1 Introducción Chapter 1 Introduction
98
CITOSOL
MITOCONDRIA
NÚCLEO
Foxo3aGenes
antioxidantes
MnSODCatalasaGPx?
Foxo3a
Ac
Foxo3a
Ciclo Krebs
Isocitrato NADPH
NADP+
GSH
GSSG
αKG
Ilustración 26 Esquema de los mecanismos de protección frente al estrés oxidativo
mediados por Sirt3. Las enzimas activadas por desacetilación se señalan con flechas negras,
las que se inhiben por la acción de la Sirt3 se muestran con barras negras. Adaptado de Bell
et al (2011)
Además, otros estudios han descrito que la Sirt3 es responsable de la desacetilación de
la Sod2 presente en la matriz mitocondrial (Chen et al 2011, Ozden et al 2011, Qiu et al
2010, Tao et al 2010). La desacetilación de esta enzima induce un aumento en su
actividad específica y consecuentemente un aumento de la neutralización de las ROS.
Por otro lado, un estudio reciente de Qiu et al (Qiu et al 2010) mostró que la restricción
calórica inducía un aumento de la desacetilación y actividad de Sod2 presumiblemente
inducida por Sirt3, estos datos fueron refrendados posteriormente por Chen et al (Chen
et al 2011) (Ilustración 26).
Como hemos mencionado, otra de las dianas de Sirt3 es la IDH, enzima del Ciclo de
Krebs que produce NADPH en la mitocondria. La GR necesita altas concentraciones de
NADPH para la reducción de GSSG a GSH que actúa como co‐factor de la mtGpx para
detoxificar las ROS (Huang et al 2010, Bell and Guarente 2011, Kong et al 2010,
Chapter 1 Introduction Capítulo 1 Introducción
99
Sundaresan et al 2009). Por otro lado, la glutamato deshidrogenasa, otra de las dianas
de la Sirt3, también tiene un papel importante en el aumento de los niveles
intramitocondriales de NADPH y podría contribuir de igual manera que la IDH a la
detoxificación de ROS en la matriz mitocondrial (Lombard et al 2007, Schlicker et al
2008) (Ilustración 26).
Numerosos estudios han propuesto el papel central de la Sirt3 como modulador de la
producción de ROS en la cadena de transporte de electrones. De hecho, otras de las
dianas fundamentales de esta sirtuina son algunas de las subunidades del complejo I
(Ahn et al 2008), complejo II (Cimen et al 2010, Finley et al 2011) y complejo III (Muller,
Liu and Van Remmen 2004, Bell and Guarente 2011) de la CTE que, como hemos
descrito anteriormente, son los principales responsables de la producción de O2*‐ a nivel
celular.
1.5 TERAPIA ANTIOXIDANTE
1.5.1 ANTIOXIDANTES COMO UNA HERRAMIENTA TERAPÉUTICA PARA COMBATIR LAS
ENFERMEDADES QUE CURSAN CON ESTRÉS OXIDATIVO Y DISFUNCIÓN MITOCONDRIAL
El uso de antioxidantes en el campo clínico para el tratamiento y la prevención de
múltiples patologías que están relacionadas en su origen o desarrolló con un aumento
del estrés oxidativo ha cobrado especial relevancia en los últimos años (Ble‐Castillo et al
2007, Bleys et al 2006). De hecho, la suplementación de la dieta con vitaminas
antioxidantes en enfermedades neurodegenerativas está ampliamente respaldado por
estudios científicos (Moreira et al 2007, Liu and Ames 2005).
En este sentido, también se han llevando a cabo diferentes investigaciones sobre el
posible papel de la suplementación con diferentes antioxidantes dietéticos o mezclas de
los mismos en la mejoría y prevención de la obesidad (Menendez‐Carreno et al 2008,
Nagao, Hase and Tokimitsu 2007, Sutherland et al 2007), aunque muchos de estos
estudios se han desarrollado en diferentes modelos animales y, por tanto, es importante
señalar que los resultados obtenidos en tales ensayos no son siempre extrapolables a
cohortes humanas.
Capítulo 1 Introducción Chapter 1 Introduction
100
Por el contrario, en algunos estudios llevados a cabo en grandes poblaciones no han
observado una disminución en la incidencia de algunas patologías como el cáncer de
próstata (Gaziano et al 2009), otros tipos de cáncer (Lee et al 2005) o la enfermedad
cardiovascular no asociada a sobrepeso u obesidad (Sesso et al 2008) tras el tratamiento
con diversos antioxidantes.
1.5.2 VITAMINA C
1.5.2.1 Estructura
La vitamina C es una vitamina hidrosoluble (Senen et al 2002) que se caracteriza porque
su composición es similar a la de un monosacárido con seis átomos de carbono
(Ilustración 27). La mayoría de las especies de mamíferos sintetizan ácido ascórbico de
novo a través de un proceso de biosíntesis que involucra a la enzima glucono γ‐lactona
oxidasa, sin embargo, los cobayas, los primates y los humanos dependen absolutamente
del abastecimiento externo de VC debido a la inactivación de esta enzima por una
mutación (Ha et al 2004), por otro lado no se acumula en el organismo lo que hace que
sus necesidades sean más elevadas que las de otros micronutrientes (Levine et al 1996).
Como hemos citado, la mutación de la glucono γ‐lactona oxidasa impide la síntesis de
esta molécula en humanos por lo que es necesaria su ingestión desde fuentes externas,
principalmente las frutas cítricas (Nishikimi and Yagi 1996) siendo la dosis diaria
recomendada es de 45 mg/d y los niveles séricos normales de 80 µM.
Ilustración 27 Estructura química de la Vitamina C
Chapter 1 Introduction Capítulo 1 Introducción
101
En el organismo actúa como antioxidante y como co‐factor de sistemas enzimáticos
(Tolbert 1985), su poder antioxidante ha sido ampliamente demostrado y ha sido objeto
de algunas revisiones bibliográficas así como el papel terapéutico en múltiples
patologías (Rodrigo et al 2007).
1.5.2.2 Función
La VC posee un elevado poder antioxidante que ha sido ampliamente descrito en
numerosos estudios y revisiones bibliográficas convirtiéndola en un antioxidante de
referencia (Arrigoni and De Tullio 2002, Meister 1992). Su potencia antioxidante se debe
principalmente a su capacidad para quelar las ROS y las ERN (Arrigoni and De Tullio
2002). Además de su papel como antioxidante en el organismo actua como co‐factor de
diversos sistemas enzimáticos (Tolbert 1985). Teniendo en cuenta estas propiedades
diversos estudios han demostrado su papel terapéutico en múltiples patologías que
cursan con un aumento del estrés oxidativo (Rodrigo, Guichard and Charles 2007).
Cuando el ácido ascórbico pierde electrones en reacciones biosintéticas o antioxidantes,
se genera un radical ascorbil oxidado de corta vida media. Éste posee un potencial de
reducción bajo en comparación con todas las especies reactivas del oxígeno y nitrógeno
(Duarte and Lunec 2005). Estas propiedades hacen del ascorbato un dador de electrones
eficiente para muchas reacciones redox biológicas, y por lo tanto, es capaz de
reemplazar estos radicales libres altamente dañinos por el radical ascorbato poco
reactivo. Cabe destacar que este intermediario inestable se convierte luego en el ácido
dehidroascórbico (ADHA, la forma oxidada del ácido ascórbico) (Ilustración 28). El ADHA
y la VC se sabe que producen distintos efectos en la función celular (Wilson 2002a,
Wilson 2002b).
Capítulo 1 Introducción Chapter 1 Introduction
102
Ilustración 28 Metabolismo redox de la vitamina C. La oxidación de un electrón del
ascorbato genera el radical libre ascorbato, con un electrón deslocalizado entre tres
átomos de oxígeno, el cual en una siguiente oxidación origina el ADHA. El ADHA es una
molécula inestable que puede ser descompuesta o reducida nuevamente a ascorbato.
Diversos estudios han avalado su utilidad en el tratamiento y prevención de la obesidad.
Así, se ha demostrado que el contenido de VC esta inversamente relacionado con la
masa corporal en humanos (Johnston 2005, Johnston and Hale 2005). Además,
individuos con adecuados niveles de VC oxidan 30% más de grasa durante el ejercicio
moderado, siendo las personas con peores niveles de VC más resistentes a la pérdida de
masa grasa. Además, bajos niveles de VC en plasma se ha relacionado con un elevado
índice cintura‐cadera (Canoy et al 2005) y con un incremento del riesgo de enfermedad
cardiovascular, especialmente en personas hipertensas y con sobrepeso (Kurl et al
2002). Asimismo, distintos estudios en humanos muestran también cómo la
suplementación con VC produce beneficios tanto en la pérdida de peso (Naylor, Grant
and Smith 1985) así como en el metabolismo lipídico y glucídico en pacientes que
presentan DMT2 (Paolisso et al 1995).
Por otro lado en estudios llevados a cabo en animales, la suplementación en la dieta con
VC mejoró la sensibilidad a la insulina en ratones hiperglicémicos ob/ob sin afectar el
peso corporal (Abdel‐Wahab et al 2002). Por el contrario, otros autores han descrito una
disminución del peso corporal tanto en ratas suplementadas con esta vitamina
(Sorensen, Devine and Rivers 1974) como la disminución en el número de adipocitos y
en el tamaño de los depósitos grasos tras la inyección de VC (Senen et al 2002). De
acuerdo con estas investigaciones, un estudio llevado a cabo por Campión y
Chapter 1 Introduction Capítulo 1 Introducción
103
colaboradores (2006) en el que se suplementó una dieta alta en grasa con 750 mg/kg de
VC durante 8 semanas se observó una disminución en la ganancia de peso corporal y en
el tamaño de los diferentes depósitos grasos (visceral, subcutáneo, epididimal y
retroperitoneal) en el grupo que recibió dicha dieta alta en grasa suplementada con VC
respecto a su control alimentado solo con la dieta de cafetería (Campion et al 2006).
Trabajos más recientes de este grupo de investigación, siguiendo el mismo modelo
experimental, confirmaron estos datos y analizaron la expresión de diferentes genes en
el tejido subcutáneo. En este sentido, la disminución producida en la expresión y los
niveles de apelina generada por la dieta alta en grasa eran parcialmente revertidos por
la suplementación con VC. Asimismo, se demostró una correlación positiva entre los
bajos niveles séricos de apelina y MDA (r=0.477) (Garcia‐Diaz et al 2007). Por otro lado,
en una publicación reciente en la que utilizaban igual modelo animal y el mismo tipo de
dieta, pero con niveles de suplementación de VC inferiores (100 mg/kg peso), los
autores observaron que a pesar de no existir diferencias en el peso corporal sí que se
daba una disminución en la oxidación del colesterol total en el grupo de animales
suplementados con VC (Menendez‐Carreno et al 2008). Estos datos podrían indicar que,
a dosis bajas de suplementación hay una disminución del estrés oxidativo aunque no
llega a tener efecto significativo sobre la ganancia de peso y la grasa corporal, efectos
que si son observados a mayores concentraciones.
1.5.3 RESVERATROL
1.5.3.1 Estructura:
El resveratrol (3,5,4’‐trihidroxiestilbeno) es una fitoalexina de naturaleza fenólica del
que existen dos formas isoméricas, el trans‐resveratrol y el cis‐resveratrol, poseyendo
actividad biológica principalmente la forma trans.
Capítulo 1 Introducción Chapter 1 Introduction
104
Ilustración 29 Estructura química del Resveratrol
Esta sustancia se encuentra presente en gran cantidad de especies vegetales,
principalmente en la piel de las uvas (Pervaiz 2003) después de la infección por Botrytis
cineara (Soleas, Diamandis and Goldberg 1997), aunque también están presentes en
otros vegetales infectados por este hongo. Así, la concentración en la uva oscila entre 50
a 100 µg/g y en el vino tinto las concentraciones del isómero trans se encuentran entre
0,1 y 15 mg/L (Fremont 2000).
1.5.3.2 Función:
Los primeros indicios acerca de los potenciales efectos beneficiosos del RSV surgieron a
partir de la llamada “paradoja francesa”, en la que se describió una baja incidencia de
enfermedades cardiovasculares en una población con un consumo elevado de grasas
saturadas en su dieta, atribuyéndose este fenómeno al alto contenido de polifenoles,
principalmente de RSV presentes en el vino tinto (Kopp 1998, Sun, Simonyi and Sun
2002). Posteriormente se ha ido profundizando en los mecanismos por los que el
resveratrol ejerce su efecto beneficioso sobre diferentes patologías como el cáncer
(Aggarwal et al 2004), la enfermedad cardiovascular (Fan et al 2008), así como en
diferentes procesos inflamatorios (Udenigwe et al 2008) y enfermedades
neurodegenerativas (Rocha‐Gonzalez, Ambriz‐Tututi and Granados‐Soto 2008, Rossi et
al 2008), entre otras patologías. Por otro lado, numerosos estudios están analizando los
mecanismos por los que el resveratrol confiere resistencia frente al estrés oxidativo.
Así, entre los principales mecanismos implicados se encuentran, en primer lugar, el
elevado potencial antioxidante del resveratrol, principalmente por la capacidad de
quelar diferentes radicales libres mediante la donación de electrones desde su grupo
Chapter 1 Introduction Capítulo 1 Introducción
105
hidroxilo (Fauconneau et al 1997, Tadolini et al 2000). Por otro lado, algunos estudios
han mostrado que el tratamiento con resveratrol activa las defensas enzimáticas
antioxidantes, aumentando la expresión génica de la Gpx, la Cat y la Sod (Ungvari et al
2007). En este sentido, numerosos trabajos han descrito que el tratamiento con
resveratrol produce una inducción progresiva de la expresión génica, los niveles de
proteína y la actividad de la Sod2 (Robb et al 2008a, Robb et al 2008b). También se ha
demostrado en cultivos celulares de hepatocitos, HepG2, el efecto activador del
resveratrol sobre la oxido nítrico sintasa endotelial (eNOS) e inducida (iNOS) (Notas et al
2006). Sin embargo, algunos autores postulan que el resveratrol ejerce su acción a
través de la activación de diferentes factores de transcripción. Así, Lagouge et al (2006),
describieron que el tratamiento con resveratrol mejoraba la funcionalidad mitocondrial
y prevenía de enfermedades metabólicas a través de la estimulación de la actividad de
Pgc1α facilitando su desacetilación por Sirt1 (Lagouge et al 2006). Esta misma vía fue
propuesta por Baur et al (2006) en una investigación en la que observaron un aumento
en la esperanza de vida de ratones obesos tratados con resveratrol frente a su grupo
control por la activación del Pgc1α a través de su desacetilación por acción de Sirt2
(Baur et al 2006).
1.6 ÁCIDO LIPOICO
1.6.1 ESTRUCTURA QUÍMICA Y FUENTES
El ácido lipoico es un ácido graso de cadena corta (8 átomos de carbono) con dos grupos
sulfidrilo en su estructura. Existen en dos isoformas: el R‐AL (que es la forma natural) y
el S‐AL (que es la forma sintética) (Estrada et al 1996). Es bien conocida su acción como
componente de varios sistemas multienzimáticos cuya función es la decarboxilación de
α‐cetoácidos y glicina así como la oxidación de acetoína a acetaldehido y AcCoA, para
llevar a cabo este papel como cofactor se liga covalentemente con un grupo amida a
través de un residuo de lisina (Patel and Packer 2008b). Estos cambios bioquímicos le
confieren propiedades reguladoras del estado redox celular. Por otro lado, puede
presentarse en su forma oxidada (AL) o en su forma reducida como ácido dihidrolipoico
(DHLA), poseyendo actividad antioxidante en ambas formas (Ilustración 30):
Capítulo 1 Introducción Chapter 1 Introduction
106
Ilustración 30 Estructura del ácido lipoico (AL) (a,b) y de su forma reducida, ácido
dihidrolipico (DHLA) (c)
De hecho, el AL in vitro es convertido rápidamente a su forma reducida a través de
reacciones tanto enzimáticas como son las mediadas por la GR, lipoamida
deshidrogenasa (LD) y TXR; como no enzimáticas, principalmente a través de reacciones
de Fenton con metales de transición (Pick et al 1995, Haramaki et al 1997). Por otro
lado, otros autores han descrito un efecto inverso del DHLA describiendo su elevada
reactividad del mismo con el oxígeno para formar O2*‐ (Han 2008) (Ilustración 31). Por
otro lado, el AL se regenera a partir del ciclo redox con otros antioxidantes como las
vitaminas C y E y aumenta los niveles del glutatión intracelular (Packer, Roy and Sen
1997, Scholich, Murphy and Sies 1989) y los niveles de la CoQ (Kagan et al 1992).
Chapter 1 Introduction Capítulo 1 Introducción
107
Ilustración 31 Vías de transformación del ácido lipoico exógeno en modelos in vitro. AL;
ácido lipoico, DHLA; ácido dihidrolipoico, BP.PDH; proteína ligada a la piruvato
deshidrogenasa, ETC; cadena de transporte de electrones, GR; glutatión reductasa, TXR;
thioredoxin reductasa.
El AL en un principio fue clasificado como una vitamina pero posteriormente se
encontró que podía ser sintetizado en humanos y en otros animales (Carreau 1979). Se
encuentra en numerosos alimentos de origen tanto vegetal como animal, si bien
contienen bajas cantidades de R‐AL en forma de lipolisina. Las principales fuentes
vegetales son espinacas (3,15±1,11 µg lipolisina/g peso seco), brócoli (0,94±0,25 µg
lipolisina/g peso seco) y los tomates (0,25±0,53 µg lipolisina/g peso seco). También está
presente en cereales integrales y en la levadura de cerveza. Además, el ácido lipoico
puede encontrarse en el hígado (2,64±1,23 µg lipolisina/g peso seco), corazón
(1,51±0,75 µg lipolisina/g peso seco) y riñón (0,86±0,33 µg lipolisina/g peso seco)
(Matsugo et al 1997, Moini, Packer and Saris 2002).
Como hemos citado puede ser producido endógenamente en el hígado a través de la
enzima ácido lipoico sintasa (LASY) (Padmalayam et al 2009, Cakatay 2007, Cakatay
2006), siendo los niveles endógenos en plasma de AL de 1‐25 ng/ml y de DHLA 30‐140
Capítulo 1 Introducción Chapter 1 Introduction
108
ng/ml (Ghibu et al 2009b). El AL se sintetiza a partir del ácido octanoico que se transfiere
a una amida del dominio lipoil por la acción de la octanoil transferasa (Cronan, Zhao and
Jiang 2005, Cronan, Fearnley and Walker 2005), los centros tiólicos son insertados en los
carbonos 6 y 8 del octanoato desde el polipeptido lipoil transferasa a través de la vía de
la s‐adenosil metionina (SAM), esta reacción es catalizada por la LASY (Cicchillo and
Booker 2005, Nesbitt et al 2005). De esta forma, el ácido lipoico queda unido al centro
lipoil de la LASY, para su liberación es necesaria la acción de la lipoamidasa que degrada
las proteínas que lo unen con la LASY (Hayakawa et al 2006). Por otro lado el AL libre
puede unirse al domino lipoil de la LASY por la acción de la lipoato ligasa que requiere
ATP para su acción (Hassan and Cronan 2011).
1.6.2 METABOLISMO DEL ÁCIDO LIPOICO
El AL se absorbe a nivel intestinal en un elevado porcentaje, en este sentido estudios
desarrollados en ratas Wistar han mostrado una absorción de aproximadamente el 90%
de la dosis oral administrada (Peter and Borbe 1995, Schupke et al 2001). De forma
parecida, estudios en humanos muestran que la absorción intestinal es rápida (< 1 hora)
y eficiente (Packer, Kraemer and Rimbach 2001, Amenta et al 2008). A pesar de estos
datos, el AL tiene una baja biodisponibilidad (0,2‐0,3) (Yadav et al 2010, Evans and
Goldfine 2000, Amenta et al 2008) y una vida media corta (<1 hora) que puede
explicarse, al menos en parte, por el importante metabolismo que sufre a su paso por el
hígado tanto en por la vía de la β‐oxidación como por la metilación de sus grupos tiol
(Teichert et al 2003) (Ilustración 32).
Chapter 1 Introduction Capítulo 1 Introducción
109
Ilustración 32 Transformaciones químicas del AL en el hígado. AL, ácido lipoico; DHLA,
ácido dihidrolipoico; BMOA, Ác. Octanoico 6,8‐bismetiltiol; BMHA, Ác. Hexanoico 4,6‐
bismetiltiol; BMBA, Ác. Butanoico 2,4 bismetiltiol; TNLA, tetranor lipoic acid; BNLA, bisnor
ácido lipoico. Adaptado de Teichert et al (2003)
Así se ha descrito que la administración oral de una dosis única o repetida de 600 mg de
AL produce picos plasmáticos después de una hora entre 10‐50 µM en varones sanos
(Teichert et al 2003, Amenta et al 2008), sin embargo las dosis efectivas determinadas
en estudios in vitro se mueven en rangos mucho más amplios (10‐250 µM) dependiendo
del estudio y del parámetro analizado (Foo et al 2011, Prieto‐Hontoria et al 2011b,
Guerriero et al 2011). Por otro lado, algunos estudios han demostrado que existe una
linealidad entre la dosis oral y los picos plasmáticos con dosis entre 50‐600 mg (Amenta
et al 2008, Breithaupt‐Grogler et al 1999), otras investigaciones han descrito que la
biodisponibilidad y el área bajo la curva de los picos plasmáticos disminuyen con la co‐
ingestión de comida (Gleiter et al 1996) así como con la velocidad del vaciamiento
gástrico (Hermann et al 1998). Por último, la biodisponibilidad del AL se encuentra
directamente relacionada con el flujo sanguíneo hepático (Patel and Packer 2008c).
Capítulo 1 Introducción Chapter 1 Introduction
110
1.6.3 FUNCIONES ANTIOXIDANTES
El papel antioxidante del AL radica tanto en su capacidad para neutralizar los radicales
libres y en su acción como regenerador de otros antioxidantes endógenos (Packer, Witt
and Tritschler 1995). Así, numerosos estudios han descrito la capacidad del AL y del
DHLA para neutralizar los H2O2, el OH*‐ y HOCl entre otros (Moini, Packer and Saris 2002,
Ghibu et al 2009b, De Araujo et al 2011). Asimismo, se ha descrito que el DHLA es capaz
de neutralizar el O2*‐ in vitro de manera comparable a la Sod (Ghibu et al 2009a). Por
otro lado, diversos estudios in vivo han demostrado que la suplementación con AL
disminuye el estrés oxidativo, por ejemplo Marangon et al mostraron que la
suplementación con 600 mg de AL durante dos meses a individuos sanos inducía una
disminución significativa en los niveles de diversos marcadores de estrés oxidativo como
la F2‐isoprostanonas, la peroxidación lipídica o un aumento en el tiempo de oxidación
de las LDL (Marangon et al 1999).
El papel del LA y del DHLA como quelantes de diferentes metales de transición (Mn2+,
Cu2+, Fe2+ y Zn2+) que pueden desencadenar procesos de oxidación ha sido descrito por
diversos autores. En este sentido Shu et al (2005) describieron en ratas que la
suplementación dietética con AL (0,2% p/p) durante dos semanas revertía la
acumulación de hierro y la deplección de GSH asociada a la edad en la corteza cerebral
(Suh et al 2005). Sin embargo, hay que destacar que la acción quelante del AL y DHLA
sobre el hierro y otros metales de transición es positiva en tejidos en los que se da una
alteración previa del metabolismo de estos metales (Bhatti et al 2005), mientras que en
tejidos sanos es posible que tenga un efecto negativo, si bien los potenciales efectos
pro‐oxidantes del AL son objeto de controversia (Cakatay 2006).
Aunque, como hemos descrito anteriormente, la biodisponibilidad del AL es muy baja y
su concentración en tejidos es muy inferior a la de otros antioxidantes endógenos como
el GSH o el ácido ascórbico (Petersen Shay et al 2008). Sorprendentemente, su potente
papel antioxidante ha sido descrito en numerosas investigaciones y en diferentes
situaciones fisiopatológicas como hemos ido describiendo. Esta aparente disparidad
puede ser explicada si se considera el AL como un “antioxidante de transición”, es decir,
una molécula capaz de activar otros sistemas antioxidantes endógenos lo que aumenta
exponencialmente su capacidad basal para disminuir el estrés oxidativo (Petersen Shay
Chapter 1 Introduction Capítulo 1 Introducción
111
et al 2008).
En este sentido, una de las principales acciones del AL es su acción sobre la regulación
de los niveles de GSH a través de la modulación de los genes implicados en la síntesis de
este antioxidante endógeno como es la regeneración de GSH tras su oxidación a GSSG.
Así, algunos estudios proponen el papel modulador del AL en la expresión de genes
implicado en la síntesis de GSH pueda estar mediada por el factor de transcripción Nrf2.
El Nrf2 es un factor de transcripción que estimula la expresión de genes regulados por el
elemento de respuesta antioxidante (ARE), entre los que se encuentran diversos genes
implicados en la síntesis de GSH (Jaiswal 2004, Itoh, Tong and Yamamoto 2004). En este
sentido, Suh et al (2004) observaron en ratas que la suplementación con AL (40 mg/kg
de peso) durante dos semanas revertía la disminución de los niveles de GSH y la
expresión de Nrf2. Además, la inyección intraperitoneal de AL (40 mg/kg de peso)
aumentaba los niveles de Nrf2 así como la unión con el DNA a las 24 horas (Suh et al
2004). Recientemente, Lii et al han descrito en hepatocitos de rata tratados con AL y
DHLA (50‐600 µM) durante 24 horas un aumento dosis dependiente en la expresión de
la glutatión‐S‐transferasa mediado por la activación de c‐Jun y la unión de Nrf2 a GPEI
(Lii et al 2010) (Ilustración 33).
Ilustración 33 Mecanismo posible de la activación de genes antioxidantes por el AL.
Adaptado de Shay et al (2009)
Capítulo 1 Introducción Chapter 1 Introduction
112
En cuanto a la capacidad del AL para regenerar GSH y otros antioxidantes endógenos
esta se basa principalmente en la rápida transformación del AL en DHLA a través de
mecanismos dependientes de NADH y NADPH incluida la cadena de transporte de
electrones, la TRX, la lipoamida deshidrogenasa o el GSSG (Haramaki et al 1997, Pick et
al 1995). El DHLA es un potente agente reductor (‐320 mV) y por tanto puede afectar a
otros pares redox. Principalmente, el par AL/DHLA afecta a los pares cisteína/cistina (‐
220 mV) y GSH/GSSG (‐240 mM) (Patel and Packer 2008a). De hecho, muchas de las
acciones biológicas del AL se deben en gran medida a la reducción de AL a DHLA y por
tanto a su capacidad para modificar el estado redox que a su vez es responsable de la
modulación de numerosas vías de señalización celular que regulan diferentes procesos
como la captación de glucosa (Packer and Cadenas 2011). Además de regenerar el GSH
el AL participa en el reciclamiento de las vitaminas C y E (Shay et al 2009) como se
recoge en la ilustración 34:
Ilustración 34 Mecanismos de regeneración de antioxidantes endógenos por acción del
AL. Adaptado de Ghibu et al (2009)
1.6.4 EL ÁCIDO LIPOICO COMO NUTRIENTE MITOCONDRIAL
Algunos autores han definido como nutrientes mitocondriales a aquellos que cumplen
las siguientes funciones (Liu 2008):
1. Previenen la generación de especies reactivas oxidantes
2. Neutralizan o inhiben la reactividad de las especies radicales
Chapter 1 Introduction Capítulo 1 Introducción
113
3. Reparan el daño oxidativo producido en diferentes estructuras celulares
mediante la activación de las defensas antioxidantes
4. Actúan como co‐factores de enzimas mitocondriales aumentando su actividad.
5. Regulan la funcionalidad y la biogénesis mitocondrial.
Como hemos descrito en el punto anterior de esta introducción el AL es capaz de
prevenir y reparar el estrés y el daño oxidativo, cumpliendo los tres primeros requisitos
de esta definición. A continuación, nos centraremos en su papel como co‐factor de
enzimas mitocondriales y regulador de la biogénesis mitocondrial. Asi, el AL juega un
papel fundamental en el metabolismo mitocondrial ya que biológicamente se encuentra
ligado covalentemente a proteínas mitocondriales en forma de lipoamida (Liu 2008,
Moini, Packer and Saris 2002, Packer and Cadenas 2011). En concreto, la reducción del
AL a DHLA se encuentra catalizada a nivel mitocondrial por subunidad E3 del complejo
lipoamida deshidrogenesa (Hong et al 1999, Sheline and Wei 2006), que a su vez es un
componente esencial de cuatro complejos mitocondriales: complejo piruvato
deshidrogenasa, complejo α‐cetoglutarato deshidrogenasa, complejo α‐cetoácido
deshidrogenasa y el sistema de hidrólisis de la glicina (Packer and Cadenas 2011, Patel
and Packer 2008a).
En cuanto al papel estimulador del AL sobre la biogénesis mitocondrial no existen
numerosos estudios si bien los más importantes se han desarrollado en los últimos años
(Shen et al 2011, Shen et al 2008a, Shen et al 2008b, Wang et al 2010b, Zhang et al
2010). Así, Wang et al (2010) en ratones C57BL/6 a los que se suplementó la dieta con
AL al 0,75% p/p durante un mes describieron que en el músculo esquelético se producía
un aumento de la biogénesis mitocondrial además de un aumento en el gasto
energético. En este mismo estudio analizaron en cultivos primarios de mioblastos los
posibles mecanismos implicados en los efectos del AL sugiriendo que podían estar
mediados por la activación de la AMPK que a su vez estimularía Pgc1α (Wang et al
2010b). Más recientemente Shen et al (2011) en la línea celular 3T3‐L1 tratada con AL
100 µM durante 24 horas observaron igualmente un aumento en la biogénesis
mitocondrial mediado por un incremento en la expresión y los niveles de proteína de
Pgc1α, Nrf1 y Tfam (Shen et al 2011).
Capítulo 1 Introducción Chapter 1 Introduction
114
1.6.5 PAPEL TERAPEÚTICO
Los potenciales efectos beneficiosos del AL sobre algunas patologías relacionadas con un
desequilibrio en el balance antioxidante/pro‐oxidante han sido analizados en numerosos
estudios clínicos. Así, se ha estudiado su papel en la diabetes (de Oliveira et al 2011,
Kandeil et al 2011, Poh and Goh 2009), la aterosclerosis (Yi et al 2011, Yi et al 2010, Ying
et al 2010, Zhang et al 2008), la hipertensión (Patel et al 2011, Ghibu et al 2009b,
Rahman et al 2011), las enfermedades neurodegenerativas (Jia et al 2009, De Araujo et
al 2011, Ahmed 2010) y la patología hepática (Guerriero et al 2011, Foo et al 2011) entre
otras. Además, la eficacia de este antioxidante en medicina preventiva ha sido
ampliamente descrita en sinergia con otros antioxidantes como la vitamina E (Gonzalez‐
Perez, Moy‐Lopez and Guzman‐Muniz 2008).
En esta tesis nos centraremos en describir brevemente el papel del AL en el tratamiento
de la obesidad y el SM así como en diferentes patologías hepáticas.
1.6.5.1 Efectos beneficiosos del AL sobre la obesidad y el síndrome metabólico
En relación a sus efectos sobre la acumulación de grasa, varios estudios han descrito sus
potenciales efectos anti‐obesidad. Así, Kim y colaboradores (2004) observaron que la
administración durante 14 semanas de este ácido (0,5% p/p) en la dieta de ratas
genéticamente obesas (OLEFT) redujo el peso corporal, la grasa visceral así como los
niveles plasmáticos de glucosa, insulina, ácidos grasos libres y leptina. Estos efectos se
han atribuido en parte a un incremento del gasto energético (por estimulación de la
UCP1 en grasa blanca y parda) así como a una inhibición de la ingesta, mediada por la
inhibición inducida sobre la AMPK hipotalámica (Kim et al 2004). Por otro lado,
investigaciones de nuestro grupo han descrito que sus efectos anti‐obesidad pueden ser
debidos a la disminución de la eficiencia energética debida en parte a la reducción de la
absorción intestinal de azúcares (Prieto‐Hontoria 2009). Más recientemente otros
estudios, realizados en modelos animales de obesidad inducida por una dieta alta en
grasa a los que se les administró ácido lipoico (0,1% p/p) durante 6 semanas, observaron
una disminución de la peroxidación lipídica así como una mejora en el perfil lipídico. En
el mismo estudio, el análisis por microarray de la expresión de genes implicados en la β‐
oxidación lipídica así como de enzimas antioxidantes, reveló que el AL inducía un
aumento en la expresión de todos ellos (Shen et al 2008b).
Chapter 1 Introduction Capítulo 1 Introducción
115
Uno de los mecanismos implicados en los efectos beneficiosos del AL sobre la obesidad y
el SM es la acción de este antioxidante sobre el metabolismo lipídico. En este sentido
Hamano et al (2006) describieron que la suplementación de la dieta de pollos con 400
mg/kg de peso durante cinco semanas mejoraba la lipolisis y la sensibilidad a la insulina
(Hamano 2006), sin embargo no hay estudios que hayan analizado el efecto lipolitico del
AL en profundidad. Por otro lado, algunos estudios que se analizaran más adelante han
descrito la capacidad del AL para disminuir la lipogénesis a nivel hepático (Huong and
Ide 2008). Otro de los mecanismos que podría estar involucrado en la reducción del
tamaño de los depósitos grasos inducido por el AL es una inhibición de la diferenciación
adipocitaria, tal y como ha sido descrito por Cho et al (2003), este estudio demostró que
el tratamiento con AL (250‐500 µM) inhibía la adipogenesis y la diferenciación de
preadipocitos 3T3‐L1 y disminuía la expresión de los genes aP2 y LPL, que se expresan
únicamente en adipocitos maduros. Estos efectos inhibitorios del AL sobre la
diferenciación adipocitaria parecen estar mediados por la reducción de los niveles de
Pparα y Crebp, así como por la activación de las MAPK (Cho et al 2003).
Por otro lado, algunos estudios recientes han descrito la capacidad del tratamiento con
AL para aumentar la biogénesis mitocondrial en diferentes modelos experimentales. Así,
Wang et al (2010) demostraron en ratones macho C57BL/6 de 24 meses de edad que
una administración de AL en el agua de bebida (0,75 %) durante un mes, provocaba una
menor ingesta de comida y una pérdida de peso acompañada de una menor ganancia de
tejido adiposo y de masa magra. Además, observaron que el grupo tratado con AL tenía
un mayor gasto energético en el músculo esquelético que pareció estar mediado por un
aumento en la biogénesis mitocondrial mediante una activación de la AMPK y el Pgc1α
(Wang et al 2010b). De acuerdo con esta investigación, Shen et al (2011) han descrito
que el tratamiento de preadipocitos 3T3L1, tras su diferenciación a adipocitos maduros,
con AL (10‐100 µM) durante 24 horas inducía un aumento en el número y la masa
mitocondrial así como un incremento en la expresión de genes implicados en la
regulación de la biogénesis mitocondrial como Pgc1α, Nrf1 o Tfam (Shen et al 2011).
Por último, diversas investigaciones han analizado el efecto del AL sobre la disminución
en la inflamación asociada a la obesidad y el SM. Así, Deiluiis et al en ratones
transgénicos c‐fmsYFP+, marcados con YFP en un promotor específico de monocitos, que
Capítulo 1 Introducción Chapter 1 Introduction
116
recibieron 6 mg de AL por día en el agua de bebida durante 8 semanas describieron que
el AL era capaz de disminuir los niveles de diversos marcadores de inflamación como el
TNFα, IL6 o la proteína quimiostática de monocitos (MCP1) en el tejido adiposo visceral
así como los niveles séricos, además detectaron por microscopía electrónica de
fluorescencia una menor infiltración de monocitos en el tejido adiposo visceral, siendo
este efecto mayor en los animales que recibieron suplementación con AL que en sus
respectivos grupos pair‐fed (Deiuliis et al 2011). Por otro lado, Zhang et al (2011) en un
estudio reciente llevado a cabo en pacientes con obesidad y DMT2 que recibieron por
vía intravenosa 600 mg de AL diarios durante dos semanas, observaron que el
tratamiento con AL inducía una mejora significativa en la sensibilidad a la insulina y
disminuía los niveles plasmáticos de MDA, 8‐iso‐prostaglandinas, IL6 y TNFα, además se
observó en este grupo de pacientes una disminución significativa en los niveles de
adiponectina (Zhang et al 2011b).
En relación a los estudios acerca de los efectos directos de la suplementación de AL en el
tratamiento de pacientes obesos cabe destacar dos estudios recientes. El primero de
ellos es el llevado a cabo por Carbonelli et al (2010) sobre una muestra de 1127
personas (445 hombres y 682 mujeres) de entre 18 y 60 años, que fueron divididas en
tres grupos en función de su IMC: normopeso, sobrepeso y obesidad. Estos pacientes
fueron tratados durante 4 meses con 800 mg/día de AL. Transcurrido el periodo de
tratamiento se observó un descenso del peso corporal de entre el 7% y el 9% y del
perímetro de la cintura, la presión arterial y los niveles plasmáticos de citoquinas pro‐
inflamatorias tanto en pacientes con sobrepeso como en aquellos con obesidad sin
distinción de género (Carbonelli et al 2010). Estos datos sugieren que podría tener un
papel importante en el tratamiento de la obesidad y sus co‐morbilidades asociadas. El
segundo estudio relevante es el desarrollado por Koh et al (2011) en una muestra de
360 individuos que padecían obesidad, DMT2, hipertensión arterial e
hipercolesterolemia (Koh et al 2011). En este estudio además de la suplementación con
AL (1200‐1800 mg/día) se llevó a cabo una intervención nutricional con una dieta
hipocalórica durante 20 semanas. Los resultados de esta investigación mostraron que
sólo la dosis más elevada de AL inducía una pérdida de peso significativamente más
elevada que la inducida por la dieta hipocalórica. A pesar de que los datos de estas
investigaciones proponen el papel beneficioso de la suplementación con AL para el
Chapter 1 Introduction Capítulo 1 Introducción
117
tratamiento de la obesidad aun son necesarios más estudios que demuestren el papel, la
dosis necesaria y la eficacia del tratamiento.
1.6.5.2 Efectos del AL en el tratamiento de la esteatosis y la fibrosis hepática
Existen pocos estudios que analicen directamente los efectos de la suplementación de la
dieta con AL en el tratamiento o la prevención de la esteatosis hepática, en concreto los
dos estudios principales se llevaron a cabo en 2008 y ambos describieron la capacidad
del AL para prevenir la esteatosis hepática. Así, Park et al (2008) describieron en un
modelo animal de obesidad inducida por la dieta en ratas que la suplementación de una
dieta alta en grasa con AL (0.5% p/p) durante tres semanas prevenía significativamente
la acumulación ectópica de grasa en el hígado y que este efecto no se debía a la
disminución en la ingesta por comparación con un grupo pair‐fed(Park et al 2008). En
relación a los mecanismos implicados en el efecto beneficioso del AL observaron una
inhibición significativa de Srebp1 tanto en el mRNA como en la proteína que parecía
secundaria por un lado a la activación de la vía de la AMPK así como a la disminución de
los niveles de mRNA y proteína de LXR y su actividad de unión al DNA por la disminución
en la fosforilación del factor de transcripción nuclear Sp1. Estos efectos fueron
confirmados con diferentes exprerimentos in vitro en la línea celular HepG2 en la que se
sobre expresó la AMPK tratados con AL (2 mM) así como en cultivos primarios de
hepatocitos de rata tratados con un agonista de LXR y con AL (0,5‐2 mM).
Por otro lado, Huong et al (2008) observaron en ratas alimentadas con una dieta alta en
grasa y azúcares que la suplementación de AL en diferentes concentraciones (1, 2,5 y 5
mg/Kg peso) durante 21 días prevenía la esteatosis hepática (Huong and Ide 2008). Estos
efectos parecían mediados por la inhibición de la actividad de varias enzimas hepáticas
implicadas en la síntesis de ácidos grasos y desaturación de los mismos (glucosa 6‐
fosfato deshidrogenasa, enzima málica, enzima piruvato quinasa, ATP‐ citrato liasa y
ácido graso sintetasa), dicha disminución se observó con todas las dosis empleadas,
salvo en el caso de la enzima málica cuyo descenso empezó a ser significativo a partir de
la dosis de 2,5 g/Kg. Esta reducción en las actividades enzimáticas se vio acompañada de
una disminución en los niveles de mRNA de otras proteínas hepáticas relacionadas con
la lipogénesis y la desaturación de ácidos grasos (Acetyl‐ CoA carboxilasa, spot 14,
adiponutrina, 5‐desaturasa, 6‐desaturasa, stearoyl‐ CoA desaturasa 1).
Capítulo 1 Introducción Chapter 1 Introduction
118
En cuanto a los efectos del AL en la prevención de la fibrosis hepática dos estudios
recientes han descrito su papel beneficioso y los posibles mecanismos implicados. Así,
Min et al (2010) observaron que el tratamiento con AL (100 mg/kg de peso) por vía
intraperitoneal durante una semana disminuía la fibrosis hepática inducida por la ligazón
del conducto biliar (LCB) en ratones, además se vio que revertía la acción del inhibidor
de la activación de plasminógeno (PAI‐1) que se está relacionado con en el desarrollo de
la fibrosis hepática. Para comprobar los mecanismos implicados en estas acciones del AL
se emplearon diversas líneas celulares (HepG2 y AML‐1) que se co‐trataron con TGFβ
(Transforming growth factor β), activador principal de PAI‐1, y diversas concentraciones
de AL (0,5‐2 mM) y observaron una disminución dosis dependiente en los niveles de PAI‐
1 y fibronectina que parece estar mediada por una activación de la vía de señalización
de las c‐Jun N‐terminal quinasas (JNK) y ERK así como una disminución de la fosforilación
de Sp1 (Min et al 2010).
Por último, Foo et al (2011) observaron que el co‐tratamiento con AL a diferentes dosis
(40, 60 y 80 mg/kg de peso) dos veces por semana por via intraperitoneal durante 12
semanas, disminuía el grado de fibrosis y cirrosis inducida por tioacetamida en ratas
Wistar con fibrosis hepática. También, observaron una disminución dosis dependiente
en los niveles de colágeno, TGFβ y α‐SMA respecto al control tratado con tioacetamida
que parecía ser debida a una activación de la vía de las MAPK y PI3K. Además, los
autores analizaron los efectos del tratamiento con DHLA en la activación de células
estelares hepáticas en la línea celular HSC‐T6, para ello indujeron su activación mediante
la administración de TGFβ y trataron con dosis variables de DHLA (6,25‐50 µM)
observando una disminución dosis dependiente en la activación de las células estelares
hepáticas debida, al menos en parte, a la fosforilación de ERK y JNK (Foo et al 2011).
Chapter 1 Introduction Capítulo 1 Introducción
119
1.7 REFERENCIAS BIBLIOGRÁFICAS
Abdel‐Wahab YH, O'Harte FP, Mooney MH, Barnett CR and Flatt PR. (2002). Vitamin C
supplementation decreases insulin glycation and improves glucose homeostasis in obese
hyperglycemic (ob/ob) mice. Metabolism. 51, 514‐7.
Abrahams JP, Leslie AG, Lutter R and Walker JE. (1994). Structure at 2.8 A resolution of F1‐
ATPase from bovine heart mitochondria. Nature. 370, 621‐8.
Abrams P and Levitt Katz LE. (2011). Metabolic effects of obesity causing disease in
childhood. Curr Opin Endocrinol Diabetes Obes. 18, 23‐7.
Abu‐Elheiga L, Brinkley WR, Zhong L, Chirala SS, Woldegiorgis G and Wakil SJ. (2000). The
subcellular localization of acetyl‐CoA carboxylase 2. Proc Natl Acad Sci U S A. 97, 1444‐9.
Adam‐Vizi V. (2005). Production of reactive oxygen species in brain mitochondria:
contribution by electron transport chain and non‐electron transport chain sources.
Antioxid Redox Signal. 7, 1140‐9.
Addabbo F, Montagnani M and Goligorsky MS. (2009). Mitochondria and Reactive Oxygen
Species. Hypertension.
Aggarwal BB, Bhardwaj A, Aggarwal RS, Seeram NP, Shishodia S and Takada Y. (2004). Role
of resveratrol in prevention and therapy of cancer: preclinical and clinical studies.
Anticancer Res. 24, 2783‐840.
Ahmed HH. (2010). Modulatory effects of vitamin E, acetyl‐l‐carnitine and alpha‐lipoic acid
on new potential biomarkers for Alzheimer's disease in rat model. Exp Toxicol Pathol.
Ahn BH, Kim HS, Song S, Lee IH, Liu J, Vassilopoulos A, Deng CX and Finkel T. (2008). A role
for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc Natl Acad
Sci U S A. 105, 14447‐52.
Albano E. (2008). Oxidative mechanisms in the pathogenesis of alcoholic liver disease. Mol
Aspects Med. 29, 9‐16.
Alberts B. BD, Lewis J., Raff M., Roberts K., Watson J. 1989. The mitochondrion. Molecular
Biolgy of the cell. 2nd ed. New York: Garland Publishing
Alhazzazi TY, Kamarajan P, Joo N, Huang JY, Verdin E, D'Silva NJ and Kapila YL. (2011).
Sirtuin‐3 (Sirt3), a novel potential therapeutic target for oral cancer. Cancer. 117, 1670‐
8.
Alp NJ and Channon KM. (2004). Regulation of endothelial nitric oxide synthase by
tetrahydrobiopterin in vascular disease. Arterioscler Thromb Vasc Biol. 24, 413‐20.
Capítulo 1 Introducción Chapter 1 Introduction
120
Amenta F, Traini E, Tomassoni D and Mignini F. (2008). Pharmacokinetics of different
formulations of tioctic (alpha‐lipoic) acid in healthy volunteers. Clin Exp Hypertens. 30,
767‐75.
Anderson S, Bankier AT, Barrell BG, de Bruijn MH, Coulson AR, Drouin J, Eperon IC, Nierlich
DP, Roe BA, Sanger F, Schreier PH, Smith AJ, Staden R and Young IG. (1981). Sequence
and organization of the human mitochondrial genome. Nature. 290, 457‐65.
Andreyev AY, Kushnareva YE and Starkov AA. (2005). Mitochondrial metabolism of reactive
oxygen species. Biochemistry (Mosc). 70, 200‐14.
Angeloni C, Motori E, Fabbri D, Malaguti M, Leoncini E, Lorenzini A and Hrelia S. (2011).
H2O2 preconditioning modulates phase II enzymes through p38 MAPK and PI3K/Akt
activation. Am J Physiol Heart Circ Physiol. 300, H2196‐205.
Angulo P, Alba LM, Petrovic LM, Adams LA, Lindor KD and Jensen MD. (2004). Leptin, insulin
resistance, and liver fibrosis in human nonalcoholic fatty liver disease. J Hepatol. 41,
943‐9.
Apovian CM. (2010). The causes, prevalence, and treatment of obesity revisited in 2009:
what have we learned so far? Am J Clin Nutr. 91, 277S‐279S.
Aquilano K, Vigilanza P, Baldelli S, Pagliei B, Rotilio G and Ciriolo MR. (2010). Peroxisome
proliferator‐activated receptor gamma co‐activator 1alpha (PGC‐1alpha) and sirtuin 1
(Sirt1) reside in mitochondria: possible direct function in mitochondrial biogenesis. J Biol
Chem. 285, 21590‐9.
Arkan MC, Hevener AL, Greten FR, Maeda S, Li ZW, Long JM, Wynshaw‐Boris A, Poli G,
Olefsky J and Karin M. (2005). IKK‐beta links inflammation to obesity‐induced insulin
resistance. Nat Med. 11, 191‐8.
Arrigoni O and De Tullio MC. (2002). Ascorbic acid: much more than just an antioxidant.
Biochim Biophys Acta. 1569, 1‐9.
Artham SM, Lavie CJ, Milani RV and Ventura HO. (2009). Obesity and hypertension, heart
failure, and coronary heart disease‐risk factor, paradox, and recommendations for
weight loss. Ochsner J. 9, 124‐32.
Babior BM. (2000). The NADPH oxidase of endothelial cells. IUBMB Life. 50, 267‐9.
Babior BM, Lambeth JD and Nauseef W. (2002). The neutrophil NADPH oxidase. Arch
Biochem Biophys. 397, 342‐4.
Bai J and Cederbaum AI. (2001). Mitochondrial catalase and oxidative injury. Biol Signals
Recept. 10, 189‐99.
Chapter 1 Introduction Capítulo 1 Introducción
121
Baker JL, Farpour‐Lambert NJ, Nowicka P, Pietrobelli A and Weiss R. (2010). Evaluation of
the overweight/obese child‐‐practical tips for the primary health care provider:
recommendations from the Childhood Obesity Task Force of the European Association
for the Study of Obesity. Obes Facts. 3, 131‐7.
Bao J, Lu Z, Joseph JJ, Carabenciov D, Dimond CC, Pang L, Samsel L, McCoy JP, Jr., Leclerc J,
Nguyen P, Gius D and Sack MN. (2010). Characterization of the murine Sirt3
mitochondrial localization sequence and comparison of mitochondrial enrichment and
deacetylase activity of long and short Sirt3 isoforms. J Cell Biochem. 110, 238‐47.
Barja G. (2007). Mitochondrial oxygen consumption and reactive oxygen species production
are independently modulated: implications for aging studies. Rejuvenation Res. 10, 215‐
24.
Barth RJ. (2011). Insulin resistance, obesity and the metabolic syndrome. S D Med. Spec No,
22‐7.
Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, Prabhu VV, Allard JS, Lopez‐
Lluch G, Lewis K, Pistell PJ, Poosala S, Becker KG, Boss O, Gwinn D, Wang M, Ramaswamy
S, Fishbein KW, Spencer RG, Lakatta EG, Le Couteur D, Shaw RJ, Navas P, Puigserver P,
Ingram DK, de Cabo R and Sinclair DA. (2006). Resveratrol improves health and survival
of mice on a high‐calorie diet. Nature. 444, 337‐42.
Beard DA, Vinnakota KC and Wu F. (2008). Detailed enzyme kinetics in terms of biochemical
species: study of citrate synthase. PLoS ONE. 3, e1825.
Bell EL and Guarente L. (2011). The SirT3 divining rod points to oxidative stress. Mol Cell.
42, 561‐8.
Bellentani S and Marino M. (2009). Epidemiology and natural history of non‐alcoholic fatty
liver disease (NAFLD). Ann Hepatol. 8 Suppl 1, S4‐8.
Bergeron R, Ren JM, Cadman KS, Moore IK, Perret P, Pypaert M, Young LH, Semenkovich CF
and Shulman GI. (2001). Chronic activation of AMP kinase results in NRF‐1 activation and
mitochondrial biogenesis. Am J Physiol Endocrinol Metab. 281, E1340‐6.
Bergman RN, Stefanovski D, Buchanan TA, Sumner AE, Reynolds JC, Sebring NG, Xiang AH
and Watanabe RM. (2011). A better index of body adiposity. Obesity (Silver Spring). 19,
1083‐9.
Bevilacqua L, Ramsey JJ, Hagopian K, Weindruch R and Harper ME. (2005). Long‐term
caloric restriction increases UCP3 content but decreases proton leak and reactive oxygen
Capítulo 1 Introducción Chapter 1 Introduction
122
species production in rat skeletal muscle mitochondria. Am J Physiol Endocrinol Metab.
289, E429‐38.
Bhatti F, Mankhey RW, Asico L, Quinn MT, Welch WJ and Maric C. (2005). Mechanisms of
antioxidant and pro‐oxidant effects of alpha‐lipoic acid in the diabetic and nondiabetic
kidney. Kidney Int. 67, 1371‐80.
Biswas M and Chan JY. (2010). Role of Nrf1 in antioxidant response element‐mediated gene
expression and beyond. Toxicol Appl Pharmacol. 244, 16‐20.
Ble‐Castillo JL, Cleva‐Villanueva G, Diaz‐Zagoya JC, Medina‐Santillan R, Rubio‐Arias HO and
Mendez JD. (2007). Effects of alpha‐Tocopherol on Oxidative Status and Metabolic
Profile in Overweight Women. Int J Environ Res Public Health. 4, 260‐267.
Bleys J, Miller ER, 3rd, Pastor‐Barriuso R, Appel LJ and Guallar E. (2006). Vitamin‐mineral
supplementation and the progression of atherosclerosis: a meta‐analysis of randomized
controlled trials. Am J Clin Nutr. 84, 880‐7; quiz 954‐5.
Bondar GF and Pisesky W. (1967). Complications of small intestinal short‐circuiting for
obesity. Arch Surg. 94, 707‐16.
Bonnefont JP, Djouadi F, Prip‐Buus C, Gobin S, Munnich A and Bastin J. (2004). Carnitine
palmitoyltransferases 1 and 2: biochemical, molecular and medical aspects. Mol Aspects
Med. 25, 495‐520.
Bordone L, Cohen D, Robinson A, Motta MC, van Veen E, Czopik A, Steele AD, Crowe H,
Marmor S, Luo J, Gu W and Guarente L. (2007). Sirt1 transgenic mice show phenotypes
resembling calorie restriction. Aging Cell. 6, 759‐67.
Borra MT, Langer MR, Slama JT and Denu JM. (2004). Substrate specificity and kinetic
mechanism of the Sir2 family of NAD+‐dependent histone/protein deacetylases.
Biochemistry (Mosc). 43, 9877‐87.
Bortolato M, Chen K and Shih JC. (2008). Monoamine oxidase inactivation: from
pathophysiology to therapeutics. Adv Drug Deliv Rev. 60, 1527‐33.
Boveris A and Cadenas E. (1975). Mitochondrial production of superoxide anions and its
relationship to the antimycin insensitive respiration. FEBS Lett. 54, 311‐4.
Boveris A, Oshino N and Chance B. (1972). The cellular production of hydrogen peroxide.
Biochem J. 128, 617‐30.
Brand MD. (2010). The sites and topology of mitochondrial superoxide production. Exp
Gerontol. 45, 466‐72.
Chapter 1 Introduction Capítulo 1 Introducción
123
Brand MD, Affourtit C, Esteves TC, Green K, Lambert AJ, Miwa S, Pakay JL and Parker N.
(2004). Mitochondrial superoxide: production, biological effects, and activation of
uncoupling proteins. Free Radic Biol Med. 37, 755‐67.
Brandt U. (2006). Energy converting NADH:quinone oxidoreductase (complex I). Annu Rev
Biochem. 75, 69‐92.
Bray GA. (2004). Medical consequences of obesity. J Clin Endocrinol Metab. 89, 2583‐9.
Bray GA and Bouchard C (eds.) 2008. Handbook of obesity: clinical applications, New York:
Informa Healthcare.
Breithaupt‐Grogler K, Niebch G, Schneider E, Erb K, Hermann R, Blume HH, Schug BS and
Belz GG. (1999). Dose‐proportionality of oral thioctic acid‐‐coincidence of assessments
via pooled plasma and individual data. Eur J Pharm Sci. 8, 57‐65.
Brookins Danz ED, Skramsted J, Henry N, Bennett JA and Keller RS. (2009). Resveratrol
prevents doxorubicin cardiotoxicity through mitochondrial stabilization and the Sirt1
pathway. Free Radic Biol Med.
Browning JD and Horton JD. (2004). Molecular mediators of hepatic steatosis and liver
injury. J Clin Invest. 114, 147‐52.
Browning JD, Szczepaniak LS, Dobbins R, Nuremberg P, Horton JD, Cohen JC, Grundy SM
and Hobbs HH. (2004). Prevalence of hepatic steatosis in an urban population in the
United States: impact of ethnicity. Hepatology. 40, 1387‐95.
Brzezinski P, Reimann J and Adelroth P. (2008). Molecular architecture of the proton diode
of cytochrome c oxidase. Biochem Soc Trans. 36, 1169‐74.
Bugianesi E, Pagotto U, Manini R, Vanni E, Gastaldelli A, de Iasio R, Gentilcore E, Natale S,
Cassader M, Rizzetto M, Pasquali R and Marchesini G. (2005). Plasma adiponectin in
nonalcoholic fatty liver is related to hepatic insulin resistance and hepatic fat content,
not to liver disease severity. J Clin Endocrinol Metab. 90, 3498‐504.
Buler M, Aatsinki SM, Skoumal R and Hakkola J. (2011). Energy sensing factors PGC‐1alpha
and Sirt1 modulate PXR expression and function. Biochem Pharmacol.
Butterfield DA. (2002). Amyloid beta‐peptide (1‐42)‐induced oxidative stress and
neurotoxicity: implications for neurodegeneration in Alzheimer's disease brain. A
review. Free Radic Res. 36, 1307‐13.
Cadenas E. (1989). Biochemistry of oxygen toxicity. Annu Rev Biochem. 58, 79‐110.
Cakatay U. (2006). Pro‐oxidant actions of alpha‐lipoic acid and dihydrolipoic acid. Med
Hypotheses. 66, 110‐7.
Capítulo 1 Introducción Chapter 1 Introduction
124
Cakatay U. (2007). Should it be safer to use a redox couple, both with (R)‐alpha‐lipoic acid
combined with (R)‐dihydrolipoic acid for avoiding prooxidant action of alpha‐lipoic acid?
Med Hypotheses. 68, 1178.
Calvo JA, Daniels TG, Wang X, Paul A, Lin J, Spiegelman BM, Stevenson SC and Rangwala SM.
(2008). Muscle‐specific expression of PPARgamma coactivator‐1alpha improves exercise
performance and increases peak oxygen uptake. J Appl Physiol. 104, 1304‐12.
Campion J, Milagro FI, Fernandez D and Martinez JA. (2006). Diferential gene expression
and adiposity reduction induced by ascorbic acid supplementation in a cafeteria model
of obesity. J Physiol Biochem. 62, 71‐80.
Canoy D, Wareham N, Welch A, Bingham S, Luben R, Day N and Khaw KT. (2005). Plasma
ascorbic acid concentrations and fat distribution in 19,068 British men and women in
the European Prospective Investigation into Cancer and Nutrition Norfolk cohort study.
Am J Clin Nutr. 82, 1203‐9.
Canto C and Auwerx J. (2009). PGC‐1alpha, Sirt1 and AMPK, an energy sensing network that
controls energy expenditure. Curr Opin Lipidol. 20, 98‐105.
Canto C, Gerhart‐Hines Z, Feige JN, Lagouge M, Noriega L, Milne JC, Elliott PJ, Puigserver P
and Auwerx J. (2009). AMPK regulates energy expenditure by modulating NAD+
metabolism and Sirt1 activity. Nature. 458, 1056‐60.
Canto C, Jiang LQ, Deshmukh AS, Mataki C, Coste A, Lagouge M, Zierath JR and Auwerx J.
(2010). Interdependence of AMPK and Sirt1 for metabolic adaptation to fasting and
exercise in skeletal muscle. Cell Metab. 11, 213‐9.
Cao W, Daniel KW, Robidoux J, Puigserver P, Medvedev AV, Bai X, Floering LM, Spiegelman
BM and Collins S. (2004). p38 mitogen‐activated protein kinase is the central regulator
of cyclic AMP‐dependent transcription of the brown fat uncoupling protein 1 gene. Mol
Cell Biol. 24, 3057‐67.
Carabelli J, Burgueno AL, Rosselli MS, Gianotti TF, Lago NR, Pirola CJ and Sookoian S. (2011).
High fat diet‐induced liver steatosis promotes an increase in liver mitochondrial
biogenesis in response to hypoxia. J Cell Mol Med. 15, 1329‐38.
Carreau JP. (1979). Biosynthesis of lipoic acid via unsaturated fatty acids. Methods Enzymol.
62, 152‐8.
Cicchillo RM and Booker SJ. (2005). Mechanistic investigations of lipoic acid biosynthesis in
Escherichia coli: both sulfur atoms in lipoic acid are contributed by the same lipoyl
synthase polypeptide. J Am Chem Soc. 127, 2860‐1.
Chapter 1 Introduction Capítulo 1 Introducción
125
Cimen H, Han MJ, Yang Y, Tong Q, Koc H and Koc EC. (2010). Regulation of succinate
dehydrogenase activity by Sirt3 in mammalian mitochondria. Biochemistry (Mosc). 49,
304‐11.
Civitarese AE, Carling S, Heilbronn LK, Hulver MH, Ukropcova B, Deutsch WA, Smith SR and
Ravussin E. (2007). Calorie restriction increases muscle mitochondrial biogenesis in
healthy humans. PLoS Med. 4, e76.
Civitarese AE, Smith SR and Ravussin E. (2007). Diet, energy metabolism and mitochondrial
biogenesis. Curr Opin Clin Nutr Metab Care. 10, 679‐87.
Clark JM, Brancati FL and Diehl AM. (2002). Nonalcoholic fatty liver disease.
Gastroenterology. 122, 1649‐57.
Clay Montier LL, Deng JJ and Bai Y. (2009). Number matters: control of mammalian
mitochondrial DNA copy number. J Genet Genomics. 36, 125‐31.
Clayton DA. (1991). Replication and transcription of vertebrate mitochondrial DNA. Annu
Rev Cell Biol. 7, 453‐78.
Clayton DA. (1992). Transcription and replication of animal mitochondrial DNAs. Int Rev
Cytol. 141, 217‐32.
Cohen DE, Supinski AM, Bonkowski MS, Donmez G and Guarente LP. (2009). Neuronal Sirt1
regulates endocrine and behavioral responses to calorie restriction. Genes Dev. 23,
2812‐7.
Cohen JC, Horton JD and Hobbs HH. (2011). Human fatty liver disease: old questions and
new insights. Science. 332, 1519‐23.
Cooper HM, Huang JY, Verdin E and Spelbrink JN. (2009). A new splice variant of the mouse
Sirt3 gene encodes the mitochondrial precursor protein. PLoS One. 4, e4986.
Cortez‐Pinto H, de Moura MC and Day CP. (2006). Non‐alcoholic steatohepatitis: from cell
biology to clinical practice. J Hepatol. 44, 197‐208.
Costa RA, Romagna CD, Pereira JL and Souza‐Pinto NC. (2011). The role of mitochondrial
DNA damage in the citotoxicity of reactive oxygen species. J Bioenerg Biomembr. 43, 25‐
9.
Crescenzo R, Lionetti L, Mollica MP, Ferraro M, D'Andrea E, Mainieri D, Dulloo AG, Liverini G
and Iossa S. (2006). Altered skeletal muscle subsarcolemmal mitochondrial
compartment during catch‐up fat after caloric restriction. Diabetes. 55, 2286‐93.
Cronan JE, Fearnley IM and Walker JE. (2005). Mammalian mitochondria contain a soluble
acyl carrier protein. FEBS Lett. 579, 4892‐6.
Capítulo 1 Introducción Chapter 1 Introduction
126
Cronan JE, Zhao X and Jiang Y. (2005). Function, attachment and synthesis of lipoic acid in
Escherichia coli. Adv Microb Physiol. 50, 103‐46.
Curat CA, Wegner V, Sengenes C, Miranville A, Tonus C, Busse R and Bouloumie A. (2006).
Macrophages in human visceral adipose tissue: increased accumulation in obesity and a
source of resistin and visfatin. Diabetologia. 49, 744‐7.
Chance B and Williams GR. (1955). Respiratory enzymes in oxidative phosphorylation. I.
Kinetics of oxygen utilization. J Biol Chem. 217, 383‐93.
Chandel NS. (2010). Mitochondrial complex III: an essential component of universal oxygen
sensing machinery? Respir Physiol Neurobiol. 174, 175‐81.
Chandrasekharan NV and Simmons DL. (2004). The cyclooxygenases. Genome Biol. 5, 241.
Chau CM, Evans MJ and Scarpulla RC. (1992). Nuclear respiratory factor 1 activation sites in
genes encoding the gamma‐subunit of ATP synthase, eukaryotic initiation factor 2 alpha,
and tyrosine aminotransferase. Specific interaction of purified NRF‐1 with multiple
target genes. J Biol Chem. 267, 6999‐7006.
Chen D, Steele AD, Lindquist S and Guarente L. (2005). Increase in activity during calorie
restriction requires Sirt1. Science. 310, 1641.
Chen Y, Zhang J, Lin Y, Lei Q, Guan KL, Zhao S and Xiong Y. (2011). Tumour suppressor Sirt3
deacetylates and activates manganese superoxide dismutase to scavenge ROS. EMBO
Rep. 12, 534‐41.
Chepelev NL, Bennitz JD, Wright JS, Smith JC and Willmore WG. (2009). Oxidative
modification of citrate synthase by peroxyl radicals and protection with novel
antioxidants. J Enzyme Inhib Med Chem. 24, 1319‐31.
Chitturi S and Farrell GC. (2001). Etiopathogenesis of nonalcoholic steatohepatitis. Semin
Liver Dis. 21, 27‐41.
Cho KJ, Moon HE, Moini H, Packer L, Yoon DY and Chung AS. (2003). Alpha‐lipoic acid
inhibits adipocyte differentiation by regulating pro‐adipogenic transcription factors via
mitogen‐activated protein kinase pathways. J Biol Chem. 278, 34823‐33.
Choudhury M, Jonscher KR and Friedman JE. (2011). Reduced mitochondrial function in
obesity‐associated fatty liver: Sirt3 takes on the fat. Aging (Albany NY). 3, 175‐8.
Chowienczyk PJ, Brett SE, Gopaul NK, Meeking D, Marchetti M, Russell‐Jones DL, Anggard
EE and Ritter JM. (2000). Oral treatment with an antioxidant (raxofelast) reduces
oxidative stress and improves endothelial function in men with type II diabetes.
Diabetologia. 43, 974‐7.
Chapter 1 Introduction Capítulo 1 Introducción
127
D'Alessandro M and Melandri BA. (2010). ATP hydrolysis in ATP synthases can be differently
coupled to proton transport and modulated by ADP and phosphate: a structure based
model of the mechanism. Biochim Biophys Acta. 1797, 755‐62.
D'Antona G, Ragni M, Cardile A, Tedesco L, Dossena M, Bruttini F, Caliaro F, Corsetti G,
Bottinelli R, Carruba MO, Valerio A and Nisoli E. (2010). Branched‐chain amino acid
supplementation promotes survival and supports cardiac and skeletal muscle
mitochondrial biogenesis in middle‐aged mice. Cell Metab. 12, 362‐72.
D'Archivio M, Annuzzi G, Vari R, Filesi C, Giacco R, Scazzocchio B, Santangelo C, Giovannini
C, Rivellese AA and Masella R. (2011). Predominant role of obesity/insulin resistance in
oxidative stress development. Eur J Clin Invest.
Danz ED, Skramsted J, Henry N, Bennett JA and Keller RS. (2009). Resveratrol prevents
doxorubicin cardiotoxicity through mitochondrial stabilization and the Sirt1 pathway.
Free Radic Biol Med. 46, 1589‐97.
Das A and Mukhopadhyay S. (2011). The evil axis of obesity, inflammation and type‐2
diabetes. Endocr Metab Immune Disord Drug Targets. 11, 23‐31.
Daussin FN, Rasseneur L, Bouitbir J, Lang AL, Dufour SP, Geny B, Burelle Y and Richard R.
(2011). Different Timing of Changes in Mitochondrial Functions following Endurance
Training. Med Sci Sports Exerc.
Day CP. (2002a). NASH‐related liver failure: one hit too many? Am J Gastroenterol. 97,
1872‐4.
Day CP. (2002b). Non‐alcoholic steatohepatitis (NASH): where are we now and where are
we going? Gut. 50, 585‐8.
Day CP. (2002c). Pathogenesis of steatohepatitis. Best Pract Res Clin Gastroenterol. 16, 663‐
78.
Day CP. (2006). Non‐alcoholic fatty liver disease: current concepts and management
strategies. Clin Med. 6, 19‐25.
De Araujo DP, Lobato Rde F, Cavalcanti JR, Sampaio LR, Araujo PV, Silva MC, Neves KR,
Fonteles MM, Sousa FC and Vasconcelos SM. (2011). The contributions of antioxidant
activity of lipoic acid in reducing neurogenerative progression of Parkinson's disease: a
review. Int J Neurosci. 121, 51‐7.
de la Lastra CA and Villegas I. (2007). Resveratrol as an antioxidant and pro‐oxidant agent:
mechanisms and clinical implications. Biochem Soc Trans. 35, 1156‐60.
Capítulo 1 Introducción Chapter 1 Introduction
128
de Oliveira AM, Rondo PH, Luzia LA, D'Abronzo FH and Illison VK. (2011). The effects of
lipoic acid and alpha‐tocopherol supplementation on the lipid profile and insulin
sensitivity of patients with type 2 diabetes mellitus: A randomized, double‐blind,
placebo‐controlled trial. Diabetes Res Clin Pract.
Dehghan M, Akhtar‐Danesh N and Merchant AT. (2005). Childhood obesity, prevalence and
prevention. Nutr J. 4, 24.
Deiuliis JA, Kampfrath T, Ying Z, Maiseyeu A and Rajagopalan S. (2011). Lipoic Acid
Attenuates Innate Immune Infiltration and Activation in the Visceral Adipose Tissue of
Obese Insulin Resistant Mice. Lipids.
Dhibi M, Brahmi F, Mnari A, Houas Z, Chargui I, Bchir L, Gazzah N, Alsaif MA and Hammami
M. (2011). The intake of high fat diet with different trans fatty acid levels differentially
induces oxidative stress and non alcoholic fatty liver disease (NAFLD) in rats. Nutr Metab
(Lond). 8, 65.
Dickinson DA, Moellering DR, Iles KE, Patel RP, Levonen AL, Wigley A, Darley‐Usmar VM and
Forman HJ. (2003). Cytoprotection against oxidative stress and the regulation of
glutathione synthesis. Biol Chem. 384, 527‐37.
Dickson VK, Silvester JA, Fearnley IM, Leslie AG and Walker JE. (2006). On the structure of
the stator of the mitochondrial ATP synthase. EMBO J. 25, 2911‐8.
Diehl AM, Li ZP, Lin HZ and Yang SQ. (2005). Cytokines and the pathogenesis of non‐
alcoholic steatohepatitis. Gut. 54, 303‐6.
Dimauro S and Rustin P. (2009). A critical approach to the therapy of mitochondrial
respiratory chain and oxidative phosphorylation diseases. Biochim Biophys Acta. 1792,
1159‐67.
Dimroth P, Kaim G and Matthey U. (2000). Crucial role of the membrane potential for ATP
synthesis by F(1)F(o) ATP synthases. J Exp Biol. 203, 51‐9.
Dixon JB, Bhathal PS and O'Brien PE. (2001). Nonalcoholic fatty liver disease: predictors of
nonalcoholic steatohepatitis and liver fibrosis in the severely obese. Gastroenterology.
121, 91‐100.
Dominy JE, Jr., Lee Y, Gerhart‐Hines Z and Puigserver P. (2010). Nutrient‐dependent
regulation of PGC‐1alpha's acetylation state and metabolic function through the
enzymatic activities of Sirt1/GCN5. Biochim Biophys Acta. 1804, 1676‐83.
Chapter 1 Introduction Capítulo 1 Introducción
129
Donnelly KL, Smith CI, Schwarzenberg SJ, Jessurun J, Boldt MD and Parks EJ. (2005). Sources
of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic
fatty liver disease. J Clin Invest. 115, 1343‐51.
Duarte TL and Lunec J. (2005). Review: When is an antioxidant not an antioxidant? A review
of novel actions and reactions of vitamin C. Free Radic Res. 39, 671‐86.
Dufour CR, Wilson BJ, Huss JM, Kelly DP, Alaynick WA, Downes M, Evans RM, Blanchette M
and Giguere V. (2007). Genome‐wide orchestration of cardiac functions by the orphan
nuclear receptors ERRalpha and gamma. Cell Metab. 5, 345‐56.
Eckel RH, Kahn SE, Ferrannini E, Goldfine AB, Nathan DM, Schwartz MW, Smith RJ and
Smith SR. (2011). Obesity and type 2 diabetes: what can be unified and what needs to be
individualized? J Clin Endocrinol Metab. 96, 1654‐63.
Egger G and Dixon J. (2011). Non‐nutrient causes of low‐grade, systemic inflammation:
support for a 'canary in the mineshaft' view of obesity in chronic disease. Obes Rev. 12,
339‐45.
Erion DM, Yonemitsu S, Nie Y, Nagai Y, Gillum MP, Hsiao JJ, Iwasaki T, Stark R, Weismann D,
Yu XX, Murray SF, Bhanot S, Monia BP, Horvath TL, Gao Q, Samuel VT and Shulman GI.
(2009). SirT1 knockdown in liver decreases basal hepatic glucose production and
increases hepatic insulin responsiveness in diabetic rats. Proc Natl Acad Sci U S A. 106,
11288‐93.
Ernster LK, B. 1970. Outer membrane of mitochondria. Membranes of Mitochondria and
Chloroplast. New York: Van Nostrand Reinhold.
Estabrook R. (1967). Mitochondrial respiratory control and the polargraphic measurement
of ADP:O ratios. Methods in enzimology. 10, 41‐47.
Estrada DE, Ewart HS, Tsakiridis T, Volchuk A, Ramlal T, Tritschler H and Klip A. (1996).
Stimulation of glucose uptake by the natural coenzyme alpha‐lipoic acid/thioctic acid:
participation of elements of the insulin signaling pathway. Diabetes. 45, 1798‐804.
Evans JL and Goldfine ID. (2000). Alpha‐lipoic acid: a multifunctional antioxidant that
improves insulin sensitivity in patients with type 2 diabetes. Diabetes Technol Ther. 2,
401‐13.
Falkenberg M, Gaspari M, Rantanen A, Trifunovic A, Larsson NG and Gustafsson CM. (2002).
Mitochondrial transcription factors B1 and B2 activate transcription of human mtDNA.
Nat Genet. 31, 289‐94.
Capítulo 1 Introducción Chapter 1 Introduction
130
Falkenberg M, Larsson NG and Gustafsson CM. (2007). DNA replication and transcription in
mammalian mitochondria. Annu Rev Biochem. 76, 679‐99.
Fan E, Zhang L, Jiang S and Bai Y. (2008). Beneficial effects of resveratrol on atherosclerosis.
J Med Food. 11, 610‐4.
Farooqi IS, Matarese G, Lord GM, Keogh JM, Lawrence E, Agwu C, Sanna V, Jebb SA, Perna
F, Fontana S, Lechler RI, DePaoli AM and O'Rahilly S. (2002). Beneficial effects of leptin
on obesity, T cell hyporesponsiveness, and neuroendocrine/metabolic dysfunction of
human congenital leptin deficiency. J Clin Invest. 110, 1093‐103.
Farrell GC and Larter CZ. (2006). Nonalcoholic fatty liver disease: from steatosis to cirrhosis.
Hepatology. 43, S99‐S112.
Fauconneau B, Waffo‐Teguo P, Huguet F, Barrier L, Decendit A and Merillon JM. (1997).
Comparative study of radical scavenger and antioxidant properties of phenolic
compounds from Vitis vinifera cell cultures using in vitro tests. Life Sci. 61, 2103‐10.
Faure P. (2003). Protective effects of antioxidant micronutrients (vitamin E, zinc and
selenium) in type 2 diabetes mellitus. Clin Chem Lab Med. 41, 995‐8.
Feige JN, Lagouge M, Canto C, Strehle A, Houten SM, Milne JC, Lambert PD, Mataki C, Elliott
PJ and Auwerx J. (2008). Specific Sirt1 activation mimics low energy levels and protects
against diet‐induced metabolic disorders by enhancing fat oxidation. Cell Metab. 8, 347‐
58.
Feldstein AE, Canbay A, Angulo P, Taniai M, Burgart LJ, Lindor KD and Gores GJ. (2003).
Hepatocyte apoptosis and fas expression are prominent features of human nonalcoholic
steatohepatitis. Gastroenterology. 125, 437‐43.
Feniouk BA, Suzuki T and Yoshida M. (2007). Regulatory interplay between proton motive
force, ADP, phosphate, and subunit epsilon in bacterial ATP synthase. J Biol Chem. 282,
764‐72.
Ferguson SJ. (2010). ATP synthase: from sequence to ring size to the P/O ratio. Proc Natl
Acad Sci U S A. 107, 16755‐6.
Fernandez‐Marcos PJ and Auwerx J. (2011). Regulation of PGC‐1alpha, a nodal regulator of
mitochondrial biogenesis. Am J Clin Nutr. 93, 884S‐90.
Fernandez‐Sanchez A, Madrigal‐Santillan E, Bautista M, Esquivel‐Soto J, Morales‐Gonzalez
A, Esquivel‐Chirino C, Durante‐Montiel I, Sanchez‐Rivera G, Valadez‐Vega C and Morales‐
Gonzalez JA. (2011). Inflammation, oxidative stress, and obesity. Int J Mol Sci. 12, 3117‐
32.
Chapter 1 Introduction Capítulo 1 Introducción
131
Finley LW, Haas W, Desquiret‐Dumas V, Wallace DC, Procaccio V, Gygi SP and Haigis MC.
(2011). Succinate dehydrogenase is a direct target of sirtuin 3 deacetylase activity. PLoS
ONE. 6, e23295.
Finucane MM, Stevens GA, Cowan MJ, Danaei G, Lin JK, Paciorek CJ, Singh GM, Gutierrez
HR, Lu Y, Bahalim AN, Farzadfar F, Riley LM and Ezzati M. (2011). National, regional, and
global trends in body‐mass index since 1980: systematic analysis of health examination
surveys and epidemiological studies with 960 country‐years and 9.1 million participants.
Lancet. 377, 557‐67.
Fisher RP, Lisowsky T, Breen GA and Clayton DA. (1991). A rapid, efficient method for
purifying DNA‐binding proteins. Denaturation‐renaturation chromatography of human
and yeast mitochondrial extracts. J Biol Chem. 266, 9153‐60.
Foo NP, Lin SH, Lee YH, Wu MJ and Wang YJ. (2011). alpha‐Lipoic acid inhibits liver fibrosis
through the attenuation of ROS‐triggered signaling in hepatic stellate cells activated by
PDGF and TGF‐beta. Toxicology. 282, 39‐46.
Ford E, Voit R, Liszt G, Magin C, Grummt I and Guarente L. (2006). Mammalian Sir2 homolog
SIRT7 is an activator of RNA polymerase I transcription. Genes Dev. 20, 1075‐80.
Fortuno A, San Jose G, Moreno MU, Beloqui O, Diez J and Zalba G. (2006). Phagocytic
NADPH oxidase overactivity underlies oxidative stress in metabolic syndrome. Diabetes.
55, 209‐15.
Francque S, De Maeght S, Adler M, Deltenre P, de Galocsy C, Orlent H, Van Steenbergen W,
Bastens B, Wain E, Langlet P, Lasser L, Verlinden W, Van Marck E and Henrion J. (2011).
High prevalence of advanced fibrosis in association with the metabolic syndrome in a
Belgian prospective cohort of NAFLD patients with elevated ALT. Results of the Belgian
NAFLD registry. Acta Gastroenterol Belg. 74, 9‐16.
Fremont L. (2000). Biological effects of resveratrol. Life Sci. 66, 663‐73.
Fridovich I. (1983). Superoxide radical: an endogenous toxicant. Annu Rev Pharmacol
Toxicol. 23, 239‐57.
Frye RA. (1999). Characterization of five human cDNAs with homology to the yeast SIR2
gene: Sir2‐like proteins (sirtuins) metabolize NAD and may have protein ADP‐
ribosyltransferase activity. Biochem Biophys Res Commun. 260, 273‐9.
Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O,
Makishima M, Matsuda M and Shimomura I. (2004). Increased oxidative stress in obesity
and its impact on metabolic syndrome. J Clin Invest. 114, 1752‐61.
Capítulo 1 Introducción Chapter 1 Introduction
132
Gadhinglajkar SV, Sreedhar R and Unnikrishnan KP. (2009). Oxygraphy: an unexplored
perioperative monitoring modality. J Clin Monit Comput. 23, 131‐5.
Gao M, Wang J, Lu N, Fang F, Liu J and Wong CW. (2011a). Mitogen‐activated protein kinase
kinases promote mitochondrial biogenesis in part through inducing peroxisome
proliferator‐activated receptor gamma coactivator‐1beta expression. Biochim Biophys
Acta. 1813, 1239‐44.
Gao M, Wang J, Wang W, Liu J and Wong CW. (2011b). Phosphatidylinositol 3‐kinase affects
mitochondrial function in part through inducing peroxisome proliferator‐activated
receptor gamma coactivator‐1beta expression. Br J Pharmacol. 162, 1000‐8.
Gao X, Wen X, Esser L, Quinn B, Yu L, Yu CA and Xia D. (2003). Structural basis for the
quinone reduction in the bc1 complex: a comparative analysis of crystal structures of
mitochondrial cytochrome bc1 with bound substrate and inhibitors at the Qi site.
Biochemistry (Mosc). 42, 9067‐80.
Garcia‐Diaz D, Campion J, Milagro FI and Martinez JA. (2007). Adiposity dependent apelin
gene expression: relationships with oxidative and inflammation markers. Mol Cell
Biochem. 305, 87‐94.
Garcia‐Monzon C, Lo Iacono O, Mayoral R, Gonzalez‐Rodriguez A, Miquilena‐Colina ME,
Lozano‐Rodriguez T, Garcia‐Pozo L, Vargas‐Castrillon J, Casado M, Bosca L, Valverde AM
and Martin‐Sanz P. (2011). Hepatic insulin resistance is associated with increased
apoptosis and fibrogenesis in nonalcoholic steatohepatitis and chronic hepatitis C. J
Hepatol. 54, 142‐52.
Garcia‐Monzon C, Martin‐Perez E, Iacono OL, Fernandez‐Bermejo M, Majano PL, Apolinario
A, Larranaga E and Moreno‐Otero R. (2000). Characterization of pathogenic and
prognostic factors of nonalcoholic steatohepatitis associated with obesity. J Hepatol. 33,
716‐24.
Gaziano JM, Glynn RJ, Christen WG, Kurth T, Belanger C, MacFadyen J, Bubes V, Manson JE,
Sesso HD and Buring JE. (2009). Vitamins E and C in the prevention of prostate and total
cancer in men: the Physicians' Health Study II randomized controlled trial. Jama. 301,
52‐62.
Gerhart‐Hines Z, Rodgers JT, Bare O, Lerin C, Kim SH, Mostoslavsky R, Alt FW, Wu Z and
Puigserver P. (2007). Metabolic control of muscle mitochondrial function and fatty acid
oxidation through Sirt1/PGC‐1alpha. EMBO J. 26, 1913‐23.
Chapter 1 Introduction Capítulo 1 Introducción
133
Ghibu S, Lauzier B, Delemasure S, Amoureux S, Sicard P, Vergely C, Muresan A, Mogosan C
and Rochette L. (2009a). Antioxidant properties of alpha‐lipoic acid: effects on red blood
membrane permeability and adaptation of isolated rat heart to reversible ischemia. Mol
Cell Biochem. 320, 141‐8.
Ghibu S, Richard C, Vergely C, Zeller M, Cottin Y and Rochette L. (2009b). Antioxidant
properties of an endogenous thiol: Alpha‐lipoic acid, useful in the prevention of
cardiovascular diseases. J Cardiovasc Pharmacol. 54, 391‐8.
Gleiter CH, Schug BS, Hermann R, Elze M, Blume HH and Gundert‐Remy U. (1996). Influence
of food intake on the bioavailability of thioctic acid enantiomers. Eur J Clin Pharmacol.
50, 513‐4.
Gleyzer N, Vercauteren K and Scarpulla RC. (2005). Control of mitochondrial transcription
specificity factors (TFB1M and TFB2M) by nuclear respiratory factors (NRF‐1 and NRF‐2)
and PGC‐1 family coactivators. Mol Cell Biol. 25, 1354‐66.
Gnaiger E. (2009). Capacity of oxidative phosphorylation in human skeletal muscle: new
perspectives of mitochondrial physiology. Int J Biochem Cell Biol. 41, 1837‐45.
Gonzalez‐Muniesa P, Milagro FI, Campion J and Martinez JA. (2006). Reduction in energy
efficiency induced by expression of the uncoupling protein, UCP1, in mouse liver
mitochondria. Int J Mol Med. 17, 591‐7.
Gonzalez‐Perez O, Moy‐Lopez NA and Guzman‐Muniz J. (2008). [Alpha‐tocopherol and
alpha‐lipoic acid. An antioxidant synergy with potential for preventive medicine]. Rev
Invest Clin. 60, 58‐67.
Guajardo‐Salinas GE and Hilmy A. (2010). Prevalence of nonalcoholic fatty liver disease
(NAFLD) and utility of FIBROspect II to detect liver fibrosis in morbidly obese Hispano‐
American patients undergoing gastric bypass. Obes Surg. 20, 1647‐53.
Guerriero E, Sorice A, Capone F, Costantini S, Palladino P, D'Ischia M and Castello G. (2011).
Effects of lipoic acid, caffeic acid and a synthesized lipoyl‐caffeic conjugate on human
hepatoma cell lines. Molecules. 16, 6365‐77.
Ha MN, Graham FL, D'Souza CK, Muller WJ, Igdoura SA and Schellhorn HE. (2004).
Functional rescue of vitamin C synthesis deficiency in human cells using adenoviral‐
based expression of murine l‐gulono‐gamma‐lactone oxidase. Genomics. 83, 482‐92.
Hagen TM, Huang S, Curnutte J, Fowler P, Martinez V, Wehr CM, Ames BN and Chisari FV.
(1994). Extensive oxidative DNA damage in hepatocytes of transgenic mice with chronic
Capítulo 1 Introducción Chapter 1 Introduction
134
active hepatitis destined to develop hepatocellular carcinoma. Proc Natl Acad Sci U S A.
91, 12808‐12.
Halliwell B. (1999). Free radical in biology and medicine. New York.
Halliwell B. (2001). Role of free radicals in the neurodegenerative diseases: therapeutic
implications for antioxidant treatment. Drugs Aging. 18, 685‐716.
Halliwell B and Whiteman M. (2004). Measuring reactive species and oxidative damage in
vivo and in cell culture: how should you do it and what do the results mean? Br J
Pharmacol. 142, 231‐55.
Hallows WC, Albaugh BN and Denu JM. (2008). Where in the cell is Sirt3?‐‐functional
localization of an NAD+‐dependent protein deacetylase. Biochem J. 411, e11‐3.
Hallows WC, Yu W, Smith BC, Devries MK, Ellinger JJ, Someya S, Shortreed MR, Prolla T,
Markley JL, Smith LM, Zhao S, Guan KL and Denu JM. (2011). Sirt3 promotes the urea
cycle and fatty acid oxidation during dietary restriction. Mol Cell. 41, 139‐49.
Hamano Y. (2006). Effects of dietary lipoic acid on plasma lipid, in vivo insulin sensitivity,
metabolic response to corticosterone and in vitro lipolysis in broiler chickens. Br J Nutr.
95, 1094‐101.
Han D, Hamilton, R.T., Lam, P.Y., Packer, L. 2008. Modulation of cellular redox and
metabolic status y lipoic acid. In: PATEL, SM, PACKER, L. (ed.) Lipoic acid: Energy
production, antioxidant activity and health effects. 1ª ed. Los Angeles, California: CRC
Press.
Han JC, Lawlor DA and Kimm SY. (2010). Childhood obesity. Lancet. 375, 1737‐48.
Handschin C and Spiegelman BM. (2006). Peroxisome proliferator‐activated receptor
gamma coactivator 1 coactivators, energy homeostasis, and metabolism. Endocr Rev. 27,
728‐35.
Hao Q, Hansen JB, Petersen RK, Hallenborg P, Jorgensen C, Cinti S, Larsen PJ, Steffensen KR,
Wang H, Collins S, Wang J, Gustafsson JA, Madsen L and Kristiansen K. (2010).
ADD1/SREBP1c activates the PGC1‐alpha promoter in brown adipocytes. Biochim
Biophys Acta. 1801, 421‐9.
Hao Q and Maret W. (2005). Imbalance between pro‐oxidant and pro‐antioxidant functions
of zinc in disease. J Alzheimers Dis. 8, 161‐70; discussion 209‐15.
Haramaki N, Han D, Handelman GJ, Tritschler HJ and Packer L. (1997). Cytosolic and
mitochondrial systems for NADH‐ and NADPH‐dependent reduction of alpha‐lipoic acid.
Free Radic Biol Med. 22, 535‐42.
Chapter 1 Introduction Capítulo 1 Introducción
135
Hassan BH and Cronan JE. (2011). Protein‐protein interactions in assembly of lipoic acid on
the 2‐oxoacid dehydrogenases of aerobic metabolism. J Biol Chem. 286, 8263‐76.
Hayakawa K, Guo L, Terentyeva EA, Li XK, Kimura H, Hirano M, Yoshikawa K, Nagamine T,
Katsumata N, Ogata T and Tanaka T. (2006). Determination of specific activities and
kinetic constants of biotinidase and lipoamidase in LEW rat and Lactobacillus casei
(Shirota). J Chromatogr B Analyt Technol Biomed Life Sci. 844, 240‐50.
Hermann R, Wildgrube HJ, Ruus P, Niebch G, Nowak H and Gleiter CH. (1998). Gastric
emptying in patients with insulin dependent diabetes mellitus and bioavailability of
thioctic acid‐enantiomers. Eur J Pharm Sci. 6, 27‐37.
Herranz D and Serrano M. (2010). Sirt1: recent lessons from mouse models. Nat Rev Cancer.
10, 819‐23.
Herzig RP, Andersson U and Scarpulla RC. (2000). Dynein light chain interacts with NRF‐1
and EWG, structurally and functionally related transcription factors from humans and
drosophila. J Cell Sci. 113 Pt 23, 4263‐73.
Herzig S, Long F, Jhala US, Hedrick S, Quinn R, Bauer A, Rudolph D, Schutz G, Yoon C,
Puigserver P, Spiegelman B and Montminy M. (2001). CREB regulates hepatic
gluconeogenesis through the coactivator PGC‐1. Nature. 413, 179‐83.
Hillon P, Guiu B, Vincent J and Petit JM. (2010). Obesity, type 2 diabetes and risk of
digestive cancer. Gastroenterol Clin Biol. 34, 529‐33.
Hills AP, Andersen LB and Byrne NM. (2011). Physical activity and obesity in children. Br J
Sports Med. 45, 866‐70.
Hinkle PC. (2005). P/O ratios of mitochondrial oxidative phosphorylation. Biochim Biophys
Acta. 1706, 1‐11.
Hinney A and Hebebrand J. (2008). Polygenic obesity in humans. Obes Facts. 1, 35‐42.
Hinney A, Vogel CI and Hebebrand J. (2010). From monogenic to polygenic obesity: recent
advances. Eur Child Adolesc Psychiatry. 19, 297‐310.
Hirschey MD, Shimazu T, Goetzman E, Jing E, Schwer B, Lombard DB, Grueter CA, Harris C,
Biddinger S, Ilkayeva OR, Stevens RD, Li Y, Saha AK, Ruderman NB, Bain JR, Newgard CB,
Farese RV, Jr., Alt FW, Kahn CR and Verdin E. (2010). Sirt3 regulates mitochondrial fatty‐
acid oxidation by reversible enzyme deacetylation. Nature. 464, 121‐5.
Hirschey MD, Shimazu T, Huang JY and Verdin E. (2009). Acetylation of mitochondrial
proteins. Methods Enzymol. 457, 137‐47.
Capítulo 1 Introducción Chapter 1 Introduction
136
Hock MB and Kralli A. (2009). Transcriptional control of mitochondrial biogenesis and
function. Annu Rev Physiol. 71, 177‐203.
Hong YS, Jacobia SJ, Packer L and Patel MS. (1999). The inhibitory effects of lipoic
compounds on mammalian pyruvate dehydrogenase complex and its catalytic
components. Free Radic Biol Med. 26, 685‐94.
Houten SM and Wanders RJ. (2010). A general introduction to the biochemistry of
mitochondrial fatty acid beta‐oxidation. J Inherit Metab Dis. 33, 469‐77.
Huang JY, Hirschey MD, Shimazu T, Ho L and Verdin E. (2010). Mitochondrial sirtuins.
Biochim Biophys Acta. 1804, 1645‐51.
Hunter SE, Jung D, Di Giulio RT and Meyer JN. (2010). The QPCR assay for analysis of
mitochondrial DNA damage, repair, and relative copy number. Methods. 51, 444‐51.
Huong DT and Ide T. (2008). Dietary lipoic acid‐dependent changes in the activity and
mRNA levels of hepatic lipogenic enzymes in rats. Br J Nutr. 100, 79‐87.
Huttemann M, Lee I, Pecinova A, Pecina P, Przyklenk K and Doan JW. (2008). Regulation of
oxidative phosphorylation, the mitochondrial membrane potential, and their role in
human disease. J Bioenerg Biomembr. 40, 445‐56.
Ide T, Shimano H, Yahagi N, Matsuzaka T, Nakakuki M, Yamamoto T, Nakagawa Y, Takahashi
A, Suzuki H, Sone H, Toyoshima H, Fukamizu A and Yamada N. (2004). SREBPs suppress
IRS‐2‐mediated insulin signalling in the liver. Nat Cell Biol. 6, 351‐7.
Itoh K, Tong KI and Yamamoto M. (2004). Molecular mechanism activating Nrf2‐Keap1
pathway in regulation of adaptive response to electrophiles. Free Radic Biol Med. 36,
1208‐13.
Iwabu M, Yamauchi T, Okada‐Iwabu M, Sato K, Nakagawa T, Funata M, Yamaguchi M,
Namiki S, Nakayama R, Tabata M, Ogata H, Kubota N, Takamoto I, Hayashi YK, Yamauchi
N, Waki H, Fukayama M, Nishino I, Tokuyama K, Ueki K, Oike Y, Ishii S, Hirose K, Shimizu
T, Touhara K and Kadowaki T. (2010). Adiponectin and AdipoR1 regulate PGC‐1alpha and
mitochondria by Ca(2+) and AMPK/Sirt1. Nature. 464, 1313‐9.
Jacobs KM, Pennington JD, Bisht KS, Aykin‐Burns N, Kim HS, Mishra M, Sun L, Nguyen P, Ahn
BH, Leclerc J, Deng CX, Spitz DR and Gius D. (2008). Sirt3 interacts with the daf‐16
homolog Foxo3a in the mitochondria, as well as increases Foxo3a dependent gene
expression. Int J Biol Sci. 4, 291‐9.
Chapter 1 Introduction Capítulo 1 Introducción
137
Jager S, Handschin C, St‐Pierre J and Spiegelman BM. (2007). AMP‐activated protein kinase
(AMPK) action in skeletal muscle via direct phosphorylation of PGC‐1alpha. Proc Natl
Acad Sci U S A. 104, 12017‐22.
Jaiswal AK. (2004). Nrf2 signaling in coordinated activation of antioxidant gene expression.
Free Radic Biol Med. 36, 1199‐207.
James O and Day C. (1999). Non‐alcoholic steatohepatitis: another disease of affluence.
Lancet. 353, 1634‐6.
Jarrett SG and Boulton ME. (2007). Poly(ADP‐ribose) polymerase offers protection against
oxidative and alkylation damage to the nuclear and mitochondrial genomes of the
retinal pigment epithelium. Ophthalmic Res. 39, 213‐23.
Javor ED, Ghany MG, Cochran EK, Oral EA, DePaoli AM, Premkumar A, Kleiner DE and
Gorden P. (2005). Leptin reverses nonalcoholic steatohepatitis in patients with severe
lipodystrophy. Hepatology. 41, 753‐60.
Jeneson JA, Schmitz JP, van den Broek NM, van Riel NA, Hilbers PA, Nicolay K and Prompers
JJ. (2009). Magnitude and control of mitochondrial sensitivity to ADP. Am J Physiol
Endocrinol Metab. 297, E774‐84.
Jensen PK. (1966). Antimycin‐insensitive oxidation of succinate and reduced nicotinamide‐
adenine dinucleotide in electron‐transport particles. II. Steroid effects. Biochim Biophys
Acta. 122, 167‐74.
Jia Z, Zhu H, Vitto MJ, Misra BR, Li Y and Misra HP. (2009). Alpha‐lipoic acid potently inhibits
peroxynitrite‐mediated DNA strand breakage and hydroxyl radical formation:
implications for the neuroprotective effects of alpha‐lipoic acid. Mol Cell Biochem. 323,
131‐8.
Jogl G and Tong L. (2003). Crystal structure of carnitine acetyltransferase and implications
for the catalytic mechanism and fatty acid transport. Cell. 112, 113‐22.
Johnston CS. (2005). Strategies for healthy weight loss: from vitamin C to the glycemic
response. J Am Coll Nutr. 24, 158‐65.
Johnston CS and Hale JC. (2005). Oxidation of ascorbic acid in stored orange juice is
associated with reduced plasma vitamin C concentrations and elevated lipid peroxides. J
Am Diet Assoc. 105, 106‐9.
Kadenbach B, Ramzan R and Vogt S. (2009). Degenerative diseases, oxidative stress and
cytochrome c oxidase function. Trends Mol Med. 15, 139‐47.
Capítulo 1 Introducción Chapter 1 Introduction
138
Kadenbach B, Ramzan R, Wen L and Vogt S. (2010). New extension of the Mitchell Theory
for oxidative phosphorylation in mitochondria of living organisms. Biochim Biophys Acta.
1800, 205‐12.
Kaeberlein M, McVey M and Guarente L. (1999). The SIR2/3/4 complex and SIR2 alone
promote longevity in Saccharomyces cerevisiae by two different mechanisms. Genes
Dev. 13, 2570‐80.
Kagan VE, Shvedova A, Serbinova E, Khan S, Swanson C, Powell R and Packer L. (1992).
Dihydrolipoic acid‐‐a universal antioxidant both in the membrane and in the aqueous
phase. Reduction of peroxyl, ascorbyl and chromanoxyl radicals. Biochem Pharmacol. 44,
1637‐49.
Kandeil MA, Amin KA, Hassanin KA, Ali KM and Mohammed ET. (2011). Role of lipoic acid on
insulin resistance and leptin in experimentally diabetic rats. J Diabetes Complications.
25, 31‐8.
Kanki T, Nakayama H, Sasaki N, Takio K, Alam TI, Hamasaki N and Kang D. (2004a).
Mitochondrial nucleoid and transcription factor A. Ann N Y Acad Sci. 1011, 61‐8.
Kanki T, Ohgaki K, Gaspari M, Gustafsson CM, Fukuoh A, Sasaki N, Hamasaki N and Kang D.
(2004b). Architectural role of mitochondrial transcription factor A in maintenance of
human mitochondrial DNA. Mol Cell Biol. 24, 9823‐34.
Kaser S, Moschen A, Cayon A, Kaser A, Crespo J, Pons‐Romero F, Ebenbichler CF, Patsch JR
and Tilg H. (2005a). Adiponectin and its receptors in non‐alcoholic steatohepatitis. Gut.
54, 117‐21.
Kaser S, Moschen A, Kaser A, Ludwiczek O, Ebenbichler CF, Vogel W, Jaschke W, Patsch JR
and Tilg H. (2005b). Circulating adiponectin reflects severity of liver disease but not
insulin sensitivity in liver cirrhosis. J Intern Med. 258, 274‐80.
Kassi E, Pervanidou P, Kaltsas G and Chrousos G. (2011). Metabolic syndrome: definitions
and controversies. BMC Med. 9, 48.
Kawahara H, Fukura M, Tsuchishima M and Takase S. (2007). Mutation of mitochondrial
DNA in livers from patients with alcoholic hepatitis and nonalcoholic steatohepatitis.
Alcohol Clin Exp Res. 31, S54‐60.
Kelly TJ, Lerin C, Haas W, Gygi SP and Puigserver P. (2009). GCN5‐mediated transcriptional
control of the metabolic coactivator PGC‐1beta through lysine acetylation. J Biol Chem.
284, 19945‐52.
Chapter 1 Introduction Capítulo 1 Introducción
139
Kerr DS. (2010). Treatment of mitochondrial electron transport chain disorders: a review of
clinical trials over the past decade. Mol Genet Metab. 99, 246‐55.
Kim MS, Park JY, Namkoong C, Jang PG, Ryu JW, Song HS, Yun JY, Namgoong IS, Ha J, Park
IS, Lee IK, Viollet B, Youn JH, Lee HK and Lee KU. (2004). Anti‐obesity effects of alpha‐
lipoic acid mediated by suppression of hypothalamic AMP‐activated protein kinase. Nat
Med. 10, 727‐33.
Klingenberg M. (2009). Cardiolipin and mitochondrial carriers. Biochim Biophys Acta. 1788,
2048‐58.
Knutti D, Kaul A and Kralli A. (2000). A tissue‐specific coactivator of steroid receptors,
identified in a functional genetic screen. Mol Cell Biol. 20, 2411‐22.
Koh EH, Lee WJ, Lee SA, Kim EH, Cho EH, Jeong E, Kim DW, Kim MS, Park JY, Park KG, Lee HJ,
Lee IK, Lim S, Jang HC, Lee KH and Lee KU. (2011). Effects of alpha‐lipoic Acid on body
weight in obese subjects. Am J Med. 124, 85 e1‐8.
Koh EH, Park JY, Park HS, Jeon MJ, Ryu JW, Kim M, Kim SY, Kim MS, Kim SW, Park IS, Youn JH
and Lee KU. (2007). Essential role of mitochondrial function in adiponectin synthesis in
adipocytes. Diabetes. 56, 2973‐81.
Kong X, Wang R, Xue Y, Liu X, Zhang H, Chen Y, Fang F and Chang Y. (2010). Sirtuin 3, a new
target of PGC‐1alpha, plays an important role in the suppression of ROS and
mitochondrial biogenesis. PLoS One. 5, e11707.
Koopman WJ, Nijtmans LG, Dieteren CE, Roestenberg P, Valsecchi F, Smeitink JA and
Willems PH. (2010). Mammalian mitochondrial complex I: biogenesis, regulation, and
reactive oxygen species generation. Antioxid Redox Signal. 12, 1431‐70.
Kopp P. (1998). Resveratrol, a phytoestrogen found in red wine. A possible explanation for
the conundrum of the 'French paradox'? Eur J Endocrinol. 138, 619‐20.
Kops GJ, Dansen TB, Polderman PE, Saarloos I, Wirtz KW, Coffer PJ, Huang TT, Bos JL,
Medema RH and Burgering BM. (2002). Forkhead transcription factor Foxo3a protects
quiescent cells from oxidative stress. Nature. 419, 316‐21.
Kowaltowski AJ, de Souza‐Pinto NC, Castilho RF and Vercesi AE. (2009). Mitochondria and
reactive oxygen species. Free Radic Biol Med. 47, 333‐43.
Krawczyk M, Bonfrate L and Portincasa P. (2010). Nonalcoholic fatty liver disease. Best Pract
Res Clin Gastroenterol. 24, 695‐708.
Kressler D, Schreiber SN, Knutti D and Kralli A. (2002). The PGC‐1‐related protein PERC is a
selective coactivator of estrogen receptor alpha. J Biol Chem. 277, 13918‐25.
Capítulo 1 Introducción Chapter 1 Introduction
140
Kris‐Etherton PM, Lefevre M, Beecher GR, Gross MD, Keen CL and Etherton TD. (2004).
Bioactive compounds in nutrition and health‐research methodologies for establishing
biological function: the antioxidant and anti‐inflammatory effects of flavonoids on
atherosclerosis. Annu Rev Nutr. 24, 511‐38.
Kurl S, Tuomainen TP, Laukkanen JA, Nyyssonen K, Lakka T, Sivenius J and Salonen JT.
(2002). Plasma vitamin C modifies the association between hypertension and risk of
stroke. Stroke. 33, 1568‐73.
Kussmaul L and Hirst J. (2006). The mechanism of superoxide production by
NADH:ubiquinone oxidoreductase (complex I) from bovine heart mitochondria. Proc
Natl Acad Sci U S A. 103, 7607‐12.
Labayen I and Martinez JA. (2002). [Distribution of macronutrients from the diet and
regulation of weight and body composition: role of lipids intake in obesity]. An Sist Sanit
Navar. 25 Suppl 1, 79‐90.
Labayen I, Ruiz JR, Ortega FB, Gottrand F, Huybrechts I, Dallongeville J, Widhalm K, Ferrari
M, Buyken A, Kersting M, Moschonis G, Turck D, Gomez S, Sjostrom M, Meirhaeghe A
and Moreno LA. (2011). Body size at birth modifies the effect of fat mass and obesity
associated (FTO) rs9939609 polymorphism on adiposity in adolescents: the Healthy
Lifestyle in Europe by Nutrition in Adolescence (HELENA) study. Br J Nutr. 1‐7.
Lagouge M, Argmann C, Gerhart‐Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N, Milne
J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P and Auwerx J. (2006). Resveratrol
improves mitochondrial function and protects against metabolic disease by activating
Sirt1 and PGC‐1alpha. Cell. 127, 1109‐22.
Lanave C, Licciulli F, De Robertis M, Marolla A and Attimonelli M. (2002). Update of
AMmtDB: a database of multi‐aligned Metazoa mitochondrial DNA sequences. Nucleic
Acids Res. 30, 174‐5.
LaRosa C and Meyers K. (2010). Epidemiology of hypertension in children and adolescents. J
Med Liban. 58, 132‐6.
Laurent A, Nicco C, Chereau C, Goulvestre C, Alexandre J, Alves A, Levy E, Goldwasser F,
Panis Y, Soubrane O, Weill B and Batteux F. (2005). Controlling tumor growth by
modulating endogenous production of reactive oxygen species. Cancer Res. 65, 948‐56.
Lavie CJ, Milani RV and Ventura HO. (2009). Obesity and cardiovascular disease: risk factor,
paradox, and impact of weight loss. J Am Coll Cardiol. 53, 1925‐32.
Chapter 1 Introduction Capítulo 1 Introducción
141
Lazar MA. (2007). Resistin‐ and Obesity‐associated metabolic diseases. Horm Metab Res.
39, 710‐6.
Lea W, Abbas AS, Sprecher H, Vockley J and Schulz H. (2000). Long‐chain acyl‐CoA
dehydrogenase is a key enzyme in the mitochondrial beta‐oxidation of unsaturated fatty
acids. Biochim Biophys Acta. 1485, 121‐8.
Lee IM, Cook NR, Gaziano JM, Gordon D, Ridker PM, Manson JE, Hennekens CH and Buring
JE. (2005). Vitamin E in the primary prevention of cardiovascular disease and cancer: the
Women's Health Study: a randomized controlled trial. Jama. 294, 56‐65.
Legros F, Malka F, Frachon P, Lombes A and Rojo M. (2004). Organization and dynamics of
human mitochondrial DNA. J Cell Sci. 117, 2653‐62.
Lelliott CJ, Ljungberg A, Ahnmark A, William‐Olsson L, Ekroos K, Elmgren A, Arnerup G,
Shoulders CC, Oscarsson J and Linden D. (2007). Hepatic PGC‐1beta overexpression
induces combined hyperlipidemia and modulates the response to PPARalpha activation.
Arterioscler Thromb Vasc Biol. 27, 2707‐13.
Lemieux H, Semsroth S, Antretter H, Hofer D and Gnaiger E. (2011). Mitochondrial
respiratory control and early defects of oxidative phosphorylation in the failing human
heart. Int J Biochem Cell Biol.
Lenaz G, Fato R, Genova ML, Bergamini C, Bianchi C and Biondi A. (2006). Mitochondrial
Complex I: structural and functional aspects. Biochim Biophys Acta. 1757, 1406‐20.
Levine M, Conry‐Cantilena C, Wang Y, Welch RW, Washko PW, Dhariwal KR, Park JB,
Lazarev A, Graumlich JF, King J and Cantilena LR. (1996). Vitamin C pharmacokinetics in
healthy volunteers: evidence for a recommended dietary allowance. Proc Natl Acad Sci
U S A. 93, 3704‐9.
Levy AP, Friedenberg P, Lotan R, Ouyang P, Tripputi M, Higginson L, Cobb FR, Tardif JC,
Bittner V and Howard BV. (2004). The effect of vitamin therapy on the progression of
coronary artery atherosclerosis varies by haptoglobin type in postmenopausal women.
Diabetes Care. 27, 925‐30.
Lewis GF, Carpentier A, Adeli K and Giacca A. (2002). Disordered fat storage and
mobilization in the pathogenesis of insulin resistance and type 2 diabetes. Endocr Rev.
23, 201‐29.
Lewis JR and Mohanty SR. (2010). Nonalcoholic fatty liver disease: a review and update. Dig
Dis Sci. 55, 560‐78.
Capítulo 1 Introducción Chapter 1 Introduction
142
Li X and Kazgan N. (2011). Mammalian sirtuins and energy metabolism. Int J Biol Sci. 7, 575‐
87.
Licinio J, Caglayan S, Ozata M, Yildiz BO, de Miranda PB, O'Kirwan F, Whitby R, Liang L,
Cohen P, Bhasin S, Krauss RM, Veldhuis JD, Wagner AJ, DePaoli AM, McCann SM and
Wong ML. (2004). Phenotypic effects of leptin replacement on morbid obesity, diabetes
mellitus, hypogonadism, and behavior in leptin‐deficient adults. Proc Natl Acad Sci U S A.
101, 4531‐6.
Lii CK, Liu KL, Cheng YP, Lin AH, Chen HW and Tsai CW. (2010). Sulforaphane and alpha‐
lipoic acid upregulate the expression of the pi class of glutathione S‐transferase through
c‐jun and Nrf2 activation. J Nutr. 140, 885‐92.
Lin J, Tarr PT, Yang R, Rhee J, Puigserver P, Newgard CB and Spiegelman BM. (2003). PGC‐
1beta in the regulation of hepatic glucose and energy metabolism. J Biol Chem. 278,
30843‐8.
Lin J, Wu H, Tarr PT, Zhang CY, Wu Z, Boss O, Michael LF, Puigserver P, Isotani E, Olson EN,
Lowell BB, Bassel‐Duby R and Spiegelman BM. (2002). Transcriptional co‐activator PGC‐1
alpha drives the formation of slow‐twitch muscle fibres. Nature. 418, 797‐801.
Lin MT and Beal MF. (2006). Mitochondrial dysfunction and oxidative stress in
neurodegenerative diseases. Nature. 443, 787‐95.
Liu J. (2008). The effects and mechanisms of mitochondrial nutrient alpha‐lipoic acid on
improving age‐associated mitochondrial and cognitive dysfunction: an overview.
Neurochem Res. 33, 194‐203.
Liu J and Ames BN. (2005). Reducing mitochondrial decay with mitochondrial nutrients to
delay and treat cognitive dysfunction, Alzheimer's disease, and Parkinson's disease. Nutr
Neurosci. 8, 67‐89.
Liu QS, Wang QJ, Du GH, Zhu SY, Gao M, Zhang L, Zhu JM and Cao JF. (2007). Recombinant
human ciliary neurotrophic factor reduces weight partly by regulating nuclear
respiratory factor 1 and mitochondrial transcription factor A. Eur J Pharmacol. 563, 77‐
82.
Liu Y, Dentin R, Chen D, Hedrick S, Ravnskjaer K, Schenk S, Milne J, Meyers DJ, Cole P, Yates
J, 3rd, Olefsky J, Guarente L and Montminy M. (2008). A fasting inducible switch
modulates gluconeogenesis via activator/coactivator exchange. Nature. 456, 269‐73.
Liu Y, Fiskum G and Schubert D. (2002). Generation of reactive oxygen species by the
mitochondrial electron transport chain. J Neurochem. 80, 780‐7.
Chapter 1 Introduction Capítulo 1 Introducción
143
Ljubicic V, Joseph AM, Saleem A, Uguccioni G, Collu‐Marchese M, Lai RY, Nguyen LM and
Hood DA. (2010). Transcriptional and post‐transcriptional regulation of mitochondrial
biogenesis in skeletal muscle: effects of exercise and aging. Biochim Biophys Acta. 1800,
223‐34.
Lombard DB, Alt FW, Cheng HL, Bunkenborg J, Streeper RS, Mostoslavsky R, Kim J,
Yancopoulos G, Valenzuela D, Murphy A, Yang Y, Chen Y, Hirschey MD, Bronson RT,
Haigis M, Guarente LP, Farese RV, Jr., Weissman S, Verdin E and Schwer B. (2007).
Mammalian Sir2 homolog Sirt3 regulates global mitochondrial lysine acetylation. Mol
Cell Biol. 27, 8807‐14.
Lonardo A, Bellini M, Tartoni P and Tondelli E. (1997). The bright liver syndrome. Prevalence
and determinants of a "bright" liver echopattern. Ital J Gastroenterol Hepatol. 29, 351‐6.
Loos RJ and Bouchard C. (2003). Obesity‐‐is it a genetic disorder? J Intern Med. 254, 401‐25.
Loschen G, Azzi A, Richter C and Flohe L. (1974). Superoxide radicals as precursors of
mitochondrial hydrogen peroxide. FEBS Lett. 42, 68‐72.
Lotscher HR, deJong C and Capaldi RA. (1984). Interconversion of high and low
adenosinetriphosphatase activity forms of Escherichia coli F1 by the detergent
lauryldimethylamine oxide. Biochemistry (Mosc). 23, 4140‐3.
Low S, Chin MC and Deurenberg‐Yap M. (2009). Review on epidemic of obesity. Ann Acad
Med Singapore. 38, 57‐9.
Ludwig J, Viggiano TR, McGill DB and Oh BJ. (1980). Nonalcoholic steatohepatitis: Mayo
Clinic experiences with a hitherto unnamed disease. Mayo Clin Proc. 55, 434‐8.
Lumeng CN and Saltiel AR. (2011). Inflammatory links between obesity and metabolic
disease. J Clin Invest. 121, 2111‐7.
Ma YS, Wu SB, Lee WY, Cheng JS and Wei YH. (2009). Response to the increase of oxidative
stress and mutation of mitochondrial DNA in aging. Biochim Biophys Acta. 1790, 1021‐9.
Macmillan‐Crow LA and Crow JP. (2011). Does More MnSOD Mean More Hydrogen
Peroxide? Anticancer Agents Med Chem.
Machado M, Marques‐Vidal P and Cortez‐Pinto H. (2006). Hepatic histology in obese
patients undergoing bariatric surgery. J Hepatol. 45, 600‐6.
Maguire D, Shah J and McCabe M. (2006). Assaying ATP synthase rotor activity. Adv Exp
Med Biol. 578, 67‐72.
Capítulo 1 Introducción Chapter 1 Introduction
144
Malinska D, Kulawiak B, Kudin AP, Kovacs R, Huchzermeyer C, Kann O, Szewczyk A and Kunz
WS. (2010). Complex III‐dependent superoxide production of brain mitochondria
contributes to seizure‐related ROS formation. Biochim Biophys Acta. 1797, 1163‐70.
Mandel SA, Avramovich‐Tirosh Y, Reznichenko L, Zheng H, Weinreb O, Amit T and Youdim
MB. (2005). Multifunctional activities of green tea catechins in neuroprotection.
Modulation of cell survival genes, iron‐dependent oxidative stress and PKC signaling
pathway. Neurosignals. 14, 46‐60.
Mangge H, Almer G, Truschnig‐Wilders M, Schmidt A, Gasser R and Fuchs D. (2010).
Inflammation, adiponectin, obesity and cardiovascular risk. Curr Med Chem. 17, 4511‐
20.
Marangon K, Devaraj S, Tirosh O, Packer L and Jialal I. (1999). Comparison of the effect of
alpha‐lipoic acid and alpha‐tocopherol supplementation on measures of oxidative stress.
Free Radic Biol Med. 27, 1114‐21.
Marceau P, Biron S, Hould FS, Marceau S, Simard S, Thung SN and Kral JG. (1999). Liver
pathology and the metabolic syndrome X in severe obesity. J Clin Endocrinol Metab. 84,
1513‐7.
Marchegiani F, Marra M, Olivieri F, Cardelli M, James RW, Boemi M and Franceschi C.
(2008). Paraoxonase 1: genetics and activities during aging. Rejuvenation Res. 11, 113‐
27.
Marchesini G, Bugianesi E, Forlani G, Cerrelli F, Lenzi M, Manini R, Natale S, Vanni E,
Villanova N, Melchionda N and Rizzetto M. (2003). Nonalcoholic fatty liver,
steatohepatitis, and the metabolic syndrome. Hepatology. 37, 917‐23.
Marchesini G, Moscatiello S, Di Domizio S and Forlani G. (2008). Obesity‐associated liver
disease. J Clin Endocrinol Metab. 93, S74‐80.
Mark N, de Alwis W and Day CP. (2010). Current and future therapeutic strategies in NAFLD.
Curr Pharm Des. 16, 1958‐62.
Martinez JA, Moreno MJ, Marques‐Lopes I and Marti A. (2002). [Causes of obesity]. An Sist
Sanit Navar. 25 Suppl 1, 17‐27.
Matsugo S, Yan LJ, Konishi T, Youn HD, Lodge JK, Ulrich H and Packer L. (1997). The lipoic
acid analogue 1,2‐diselenolane‐3‐pentanoic acid protects human low density lipoprotein
against oxidative modification mediated by copper ion. Biochem Biophys Res Commun.
240, 819‐24.
Chapter 1 Introduction Capítulo 1 Introducción
145
Matsuzawa Y. (2010). Adiponectin: a key player in obesity related disorders. Curr Pharm
Des. 16, 1896‐901.
May JM. (2000). How does ascorbic acid prevent endothelial dysfunction? Free Radic Biol
Med. 28, 1421‐9.
McCord JM and Fridovich I. (1968). The reduction of cytochrome c by milk xanthine oxidase.
J Biol Chem. 243, 5753‐60.
McCullough AJ. (2002). Update on nonalcoholic fatty liver disease. J Clin Gastroenterol. 34,
255‐62.
Meirhaeghe A, Crowley V, Lenaghan C, Lelliott C, Green K, Stewart A, Hart K, Schinner S,
Sethi JK, Yeo G, Brand MD, Cortright RN, O'Rahilly S, Montague C and Vidal‐Puig AJ.
(2003). Characterization of the human, mouse and rat PGC1 beta (peroxisome‐
proliferator‐activated receptor‐gamma co‐activator 1 beta) gene in vitro and in vivo.
Biochem J. 373, 155‐65.
Meister A. (1992). On the antioxidant effects of ascorbic acid and glutathione. Biochem
Pharmacol. 44, 1905‐15.
Menendez‐Carreno M, Ansorena D, Milagro FI, Campion J, Martinez JA and Astiasaran I.
(2008). Inhibition of Serum Cholesterol Oxidation by Dietary Vitamin C and Selenium
Intake in High Fat Fed Rats. Lipids.
Mick DU, Fox TD and Rehling P. (2011). Inventory control: cytochrome c oxidase assembly
regulates mitochondrial translation. Nat Rev Mol Cell Biol. 12, 14‐20.
Michan S and Sinclair D. (2007). Sirtuins in mammals: insights into their biological function.
Biochem J. 404, 1‐13.
Milne JC, Lambert PD, Schenk S, Carney DP, Smith JJ, Gagne DJ, Jin L, Boss O, Perni RB, Vu
CB, Bemis JE, Xie R, Disch JS, Ng PY, Nunes JJ, Lynch AV, Yang H, Galonek H, Israelian K,
Choy W, Iffland A, Lavu S, Medvedik O, Sinclair DA, Olefsky JM, Jirousek MR, Elliott PJ
and Westphal CH. (2007). Small molecule activators of Sirt1 as therapeutics for the
treatment of type 2 diabetes. Nature. 450, 712‐6.
Miller FJ, Rosenfeldt FL, Zhang C, Linnane AW and Nagley P. (2003). Precise determination
of mitochondrial DNA copy number in human skeletal and cardiac muscle by a PCR‐
based assay: lack of change of copy number with age. Nucleic Acids Res. 31, e61.
Min AK, Kim MK, Seo HY, Kim HS, Jang BK, Hwang JS, Choi HS, Lee KU, Park KG and Lee IK.
(2010). Alpha‐lipoic acid inhibits hepatic PAI‐1 expression and fibrosis by inhibiting the
TGF‐beta signaling pathway. Biochem Biophys Res Commun. 393, 536‐41.
Capítulo 1 Introducción Chapter 1 Introduction
146
Misra A and Khurana L. (2008). Obesity and the metabolic syndrome in developing
countries. J Clin Endocrinol Metab. 93, S9‐30.
Mitchell P. (1961). Coupling of phosphorylation to electron and hydrogen transfer by a
chemi‐osmotic type of mechanism. Nature. 191, 144‐8.
Miwa S and Brand MD. (2005). The topology of superoxide production by complex III and
glycerol 3‐phosphate dehydrogenase in Drosophila mitochondria. Biochim Biophys Acta.
1709, 214‐9.
Moini H, Packer L and Saris NE. (2002). Antioxidant and prooxidant activities of alpha‐lipoic
acid and dihydrolipoic acid. Toxicol Appl Pharmacol. 182, 84‐90.
Moleres A, Ochoa MC, Rendo‐Urteaga T, Martinez‐Gonzalez MA, Azcona San Julian MC,
Martinez JA and Marti A. (2011). Dietary fatty acid distribution modifies obesity risk
linked to the rs9939609 polymorphism of the fat mass and obesity‐associated gene in a
Spanish case‐control study of children. Br J Nutr. 1‐6.
Monsalve M, Wu Z, Adelmant G, Puigserver P, Fan M and Spiegelman BM. (2000). Direct
coupling of transcription and mRNA processing through the thermogenic coactivator
PGC‐1. Mol Cell. 6, 307‐16.
Moore JB. (2010). Non‐alcoholic fatty liver disease: the hepatic consequence of obesity and
the metabolic syndrome. Proc Nutr Soc. 69, 211‐20.
Mootha VK, Handschin C, Arlow D, Xie X, St Pierre J, Sihag S, Yang W, Altshuler D, Puigserver
P, Patterson N, Willy PJ, Schulman IG, Heyman RA, Lander ES and Spiegelman BM.
(2004). Erralpha and Gabpa/b specify PGC‐1alpha‐dependent oxidative phosphorylation
gene expression that is altered in diabetic muscle. Proc Natl Acad Sci U S A. 101, 6570‐5.
Moreira PI, Harris PL, Zhu X, Santos MS, Oliveira CR, Smith MA and Perry G. (2007). Lipoic
acid and N‐acetyl cysteine decrease mitochondrial‐related oxidative stress in Alzheimer
disease patient fibroblasts. J Alzheimers Dis. 12, 195‐206.
Moreno‐Aliaga MC, J; Milagro, F.I: Berjón, A; Martinez, JA (2005). "Adiposity and
proinflammatory state: the chicken or the egg". Adipocytes. 1, 1:16.
Morse SA, Gulati R and Reisin E. (2010). The obesity paradox and cardiovascular disease.
Curr Hypertens Rep. 12, 120‐6.
Motta MC, Divecha N, Lemieux M, Kamel C, Chen D, Gu W, Bultsma Y, McBurney M and
Guarente L. (2004). Mammalian Sirt1 represses forkhead transcription factors. Cell. 116,
551‐63.
Chapter 1 Introduction Capítulo 1 Introducción
147
Moxley RT, 3rd, Pozefsky T and Lockwood DH. (1974). Protein nutrition and liver disease
after jejunoileal bypass for morbid obesity. N Engl J Med. 290, 921‐6.
Muller FL, Liu Y and Van Remmen H. (2004). Complex III releases superoxide to both sides
of the inner mitochondrial membrane. J Biol Chem. 279, 49064‐73.
Muller TD, Hinney A, Scherag A, Nguyen TT, Schreiner F, Schafer H, Hebebrand J, Roth CL
and Reinehr T. (2008). 'Fat mass and obesity associated' gene (FTO): no significant
association of variant rs9939609 with weight loss in a lifestyle intervention and lipid
metabolism markers in German obese children and adolescents. BMC Med Genet. 9, 85.
Murphy MP. (2009). How mitochondria produce reactive oxygen species. Biochem J. 417, 1‐
13.
Musaiger AO. (2011). Overweight and Obesity in Eastern Mediterranean Region: Prevalence
and Possible Causes. J Obes. 2011, 407237.
Must A and Parisi SM. (2009). Sedentary behavior and sleep: paradoxical effects in
association with childhood obesity. Int J Obes (Lond). 33 Suppl 1, S82‐6.
Myers MG, Jr., Leibel RL, Seeley RJ and Schwartz MW. (2010). Obesity and leptin resistance:
distinguishing cause from effect. Trends Endocrinol Metab. 21, 643‐51.
Nagao T, Hase T and Tokimitsu I. (2007). A green tea extract high in catechins reduces body
fat and cardiovascular risks in humans. Obesity (Silver Spring). 15, 1473‐83.
Nakamoto RK, Baylis Scanlon JA and Al‐Shawi MK. (2008). The rotary mechanism of the ATP
synthase. Arch Biochem Biophys. 476, 43‐50.
Narasimhan S, Gokulakrishnan K, Sampathkumar R, Farooq S, Ravikumar R, Mohan V and
Balasubramanyam M. (2010). Oxidative stress is independently associated with non‐
alcoholic fatty liver disease (NAFLD) in subjects with and without type 2 diabetes. Clin
Biochem. 43, 815‐21.
Nath S. (2010a). Beyond the chemiosmotic theory: analysis of key fundamental aspects of
energy coupling in oxidative phosphorylation in the light of a torsional mechanism of
energy transduction and ATP synthesis‐‐invited review part 1. J Bioenerg Biomembr. 42,
293‐300.
Nath S. (2010b). Beyond the chemiosmotic theory: analysis of key fundamental aspects of
energy coupling in oxidative phosphorylation in the light of a torsional mechanism of
energy transduction and ATP synthesis‐‐invited review part 2. J Bioenerg Biomembr. 42,
301‐9.
Capítulo 1 Introducción Chapter 1 Introduction
148
Naylor GJ, Grant L and Smith C. (1985). A double blind placebo controlled trial of ascorbic
acid in obesity. Nutr Health. 4, 25‐8.
Nesbitt NM, Baleanu‐Gogonea C, Cicchillo RM, Goodson K, Iwig DF, Broadwater JA, Haas JA,
Fox BG and Booker SJ. (2005). Expression, purification, and physical characterization of
Escherichia coli lipoyl(octanoyl)transferase. Protein Expr Purif. 39, 269‐82.
Neubert D and Lehninger AL. (1962). The effect of thiols and disulfides on water uptake and
extrusion by rat liver mitochondria. J Biol Chem. 237, 952‐8.
Nishikimi M and Yagi K. (1996). Biochemistry and molecular biology of ascorbic acid
biosynthesis. Subcell Biochem. 25, 17‐39.
Nisoli E, Clementi E, Moncada S and Carruba MO. (2004). Mitochondrial biogenesis as a
cellular signaling framework. Biochem Pharmacol. 67, 1‐15.
Nisoli E, Tonello C, Cardile A, Cozzi V, Bracale R, Tedesco L, Falcone S, Valerio A, Cantoni O,
Clementi E, Moncada S and Carruba MO. (2005). Calorie restriction promotes
mitochondrial biogenesis by inducing the expression of eNOS. Science. 310, 314‐7.
Nomura H, Kashiwagi S, Hayashi J, Kajiyama W, Tani S and Goto M. (1988). Prevalence of
fatty liver in a general population of Okinawa, Japan. Jpn J Med. 27, 142‐9.
North BJ and Sinclair DA. (2007). Sirtuins: a conserved key unlocking AceCS activity. Trends
Biochem Sci. 32, 1‐4.
Notas G, Nifli AP, Kampa M, Vercauteren J, Kouroumalis E and Castanas E. (2006).
Resveratrol exerts its antiproliferative effect on HepG2 hepatocellular carcinoma cells,
by inducing cell cycle arrest, and NOS activation. Biochim Biophys Acta. 1760, 1657‐66.
Ongwijitwat S and Wong‐Riley MT. (2004). Functional analysis of the rat cytochrome c
oxidase subunit 6A1 promoter in primary neurons. Gene. 337, 163‐71.
Orrenius S, Gogvadze V and Zhivotovsky B. (2007). Mitochondrial oxidative stress:
implications for cell death. Annu Rev Pharmacol Toxicol. 47, 143‐83.
Orsucci D, Mancuso M and Siciliano G. (2008). Mitochondria, oxidative stress and Parp‐1
network: a new target for neuroprotective effects of tetracyclines? J Physiol. 586, 2427‐
8.
Oswal A and Yeo G. (2010). Leptin and the control of body weight: a review of its diverse
central targets, signaling mechanisms, and role in the pathogenesis of obesity. Obesity
(Silver Spring). 18, 221‐9.
Ott M, Zhivotovsky B and Orrenius S. (2007). Role of cardiolipin in cytochrome c release
from mitochondria. Cell Death Differ. 14, 1243‐7.
Chapter 1 Introduction Capítulo 1 Introducción
149
Ozden O, Park SH, Kim HS, Jiang H, Coleman MC, Spitz DR and Gius D. (2011). Acetylation of
MnSOD directs enzymatic activity responding to cellular nutrient status or oxidative
stress. Aging (Albany NY). 3, 102‐7.
Pacifico L, Anania C, Martino F, Poggiogalle E, Chiarelli F, Arca M and Chiesa C. (2011a).
Management of metabolic syndrome in children and adolescents. Nutr Metab
Cardiovasc Dis. 21, 455‐66.
Pacifico L, Nobili V, Anania C, Verdecchia P and Chiesa C. (2011b). Pediatric nonalcoholic
fatty liver disease, metabolic syndrome and cardiovascular risk. World J Gastroenterol.
17, 3082‐91.
Packer L and Cadenas E. (2011). Lipoic acid: energy metabolism and redox regulation of
transcription and cell signaling. J Clin Biochem Nutr. 48, 26‐32.
Packer L, Kraemer K and Rimbach G. (2001). Molecular aspects of lipoic acid in the
prevention of diabetes complications. Nutrition. 17, 888‐95.
Packer L, Roy S and Sen CK. (1997). Alpha‐lipoic acid: a metabolic antioxidant and potential
redox modulator of transcription. Adv Pharmacol. 38, 79‐101.
Packer L, Witt EH and Tritschler HJ. (1995). alpha‐Lipoic acid as a biological antioxidant. Free
Radic Biol Med. 19, 227‐50.
Pacher P, Nivorozhkin A and Szabo C. (2006). Therapeutic effects of xanthine oxidase
inhibitors: renaissance half a century after the discovery of allopurinol. Pharmacol Rev.
58, 87‐114.
Padmalayam I, Hasham S, Saxena U and Pillarisetti S. (2009). Lipoic acid synthase (LASY): a
novel role in inflammation, mitochondrial function, and insulin resistance. Diabetes. 58,
600‐8.
Paolisso G, Balbi V, Volpe C, Varricchio G, Gambardella A, Saccomanno F, Ammendola S,
Varricchio M and D'Onofrio F. (1995). Metabolic benefits deriving from chronic vitamin C
supplementation in aged non‐insulin dependent diabetics. J Am Coll Nutr. 14, 387‐92.
Parisi MA and Clayton DA. (1991). Similarity of human mitochondrial transcription factor 1
to high mobility group proteins. Science. 252, 965‐9.
Park KG, Min AK, Koh EH, Kim HS, Kim MO, Park HS, Kim YD, Yoon TS, Jang BK, Hwang JS,
Kim JB, Choi HS, Park JY, Lee IK and Lee KU. (2008). Alpha‐lipoic acid decreases hepatic
lipogenesis through adenosine monophosphate‐activated protein kinase (AMPK)‐
dependent and AMPK‐independent pathways. Hepatology. 48, 1477‐86.
Capítulo 1 Introducción Chapter 1 Introduction
150
Pastor N, Weinstein H, Jamison E and Brenowitz M. (2000). A detailed interpretation of OH
radical footprints in a TBP‐DNA complex reveals the role of dynamics in the mechanism
of sequence‐specific binding. J Mol Biol. 304, 55‐68.
Patel J, Matnor NA, Iyer A and Brown L. (2011). A Regenerative Antioxidant Protocol of
Vitamin E and alpha‐Lipoic Acid Ameliorates Cardiovascular and Metabolic Changes in
Fructose‐Fed Rats. Evid Based Complement Alternat Med. 2011, 120801.
Patel MS and Packer L (eds.) 2008a. Lipoic Acid: Energy production, anrioxidant activity and
health effects, Boca Raton: CRC Press.
Patel MS and Packer L (eds.) 2008b. Lipoic Acid: Energy production, anrioxidant activity and
health effects, Boca Raton: CRC Press.
Patel MS and Packer L (eds.) 2008c. Lipoic Acid: Energy production, anrioxidant activity and
health effects, Boca Raton: CRC Press.
Payne JH, Dewind LT and Commons RR. (1963). Metabolic Observations in Patients with
Jejunocolic Shunts. Am J Surg. 106, 273‐89.
Pecqueur C, Alves‐Guerra MC, Gelly C, Levi‐Meyrueis C, Couplan E, Collins S, Ricquier D,
Bouillaud F and Miroux B. (2001). Uncoupling protein 2, in vivo distribution, induction
upon oxidative stress, and evidence for translational regulation. J Biol Chem. 276, 8705‐
12.
Peng Y, Rideout D, Rakita S, Lee J and Murr M. (2011). Diet‐induced obesity associated with
steatosis, oxidative stress, and inflammation in liver. Surg Obes Relat Dis.
Pervaiz S. (2003). Resveratrol: from grapevines to mammalian biology. Faseb J. 17, 1975‐85.
Pessayre D. (2007). Role of mitochondria in non‐alcoholic fatty liver disease. J Gastroenterol
Hepatol. 22 Suppl 1, S20‐7.
Pessayre D, Berson A, Fromenty B and Mansouri A. (2001). Mitochondria in steatohepatitis.
Semin Liver Dis. 21, 57‐69.
Peter G and Borbe HO. (1995). Absorption of [7,8‐14C]rac‐a‐lipoic acid from in situ ligated
segments of the gastrointestinal tract of the rat. Arzneimittelforschung. 45, 293‐9.
Petersen KF, Befroy D, Dufour S, Dziura J, Ariyan C, Rothman DL, DiPietro L, Cline GW and
Shulman GI. (2003). Mitochondrial dysfunction in the elderly: possible role in insulin
resistance. Science. 300, 1140‐2.
Petersen Shay K, Moreau RF, Smith EJ and Hagen TM. (2008). Is alpha‐lipoic acid a
scavenger of reactive oxygen species in vivo? Evidence for its initiation of stress signaling
pathways that promote endogenous antioxidant capacity. IUBMB Life. 60, 362‐7.
Chapter 1 Introduction Capítulo 1 Introducción
151
Pham DQ and Plakogiannis R. (2005). Vitamin E supplementation in cardiovascular disease
and cancer prevention: Part 1. Ann Pharmacother. 39, 1870‐8.
Piantadosi CA and Suliman HB. (2006). Mitochondrial transcription factor A induction by
redox activation of nuclear respiratory factor 1. J Biol Chem. 281, 324‐33.
Pick U, Haramaki N, Constantinescu A, Handelman GJ, Tritschler HJ and Packer L. (1995).
Glutathione reductase and lipoamide dehydrogenase have opposite stereospecificities
for alpha‐lipoic acid enantiomers. Biochem Biophys Res Commun. 206, 724‐30.
Poh ZX and Goh KP. (2009). A current update on the use of alpha lipoic acid in the
management of type 2 diabetes mellitus. Endocr Metab Immune Disord Drug Targets. 9,
392‐8.
Pomplun D, Voigt A, Schulz TJ, Thierbach R, Pfeiffer AF and Ristow M. (2007). Reduced
expression of mitochondrial frataxin in mice exacerbates diet‐induced obesity. Proc Natl
Acad Sci U S A. 104, 6377‐81.
Ponugoti B, Kim DH, Xiao Z, Smith Z, Miao J, Zang M, Wu SY, Chiang CM, Veenstra TD and
Kemper JK. (2010). Sirt1 deacetylates and inhibits SREBP‐1C activity in regulation of
hepatic lipid metabolism. J Biol Chem. 285, 33959‐70.
Powers KA, Rehrig ST and Jones DB. (2007). Financial impact of obesity and bariatric
surgery. Med Clin North Am. 91, 321‐38, ix.
Prieto‐Hontoria PL, Perez‐Matute P, Fernandez‐Galilea M, Bustos M, Martinez JA and
Moreno‐Aliaga MJ. (2011a). Role of obesity‐associated dysfunctional adipose tissue in
cancer: a molecular nutrition approach. Biochim Biophys Acta. 1807, 664‐78.
Prieto‐Hontoria PL, Perez‐Matute P, Fernandez‐Galilea M, Martinez JA and Moreno‐Aliaga
MJ. (2011b). Lipoic acid inhibits leptin secretion and Sp1 activity in adipocytes. Mol Nutr
Food Res. 55, 1059‐69.
Prieto‐Hontoria PL, Pérez‐Matute P., Fernández‐Galilea M., Martínez J.A., Moreno‐Aliaga
M.J.. (2009). Lipoic acid prevents body weight gain induced by a high fat diet in rats:
Effects on intestinal sugar transport. Journal of Physiology and Biochemestry. 65, 43‐50.
Puigserver P. (2005). Tissue‐specific regulation of metabolic pathways through the
transcriptional coactivator PGC1‐alpha. Int J Obes (Lond). 29 Suppl 1, S5‐9.
Puigserver P, Rhee J, Lin J, Wu Z, Yoon JC, Zhang CY, Krauss S, Mootha VK, Lowell BB and
Spiegelman BM. (2001). Cytokine stimulation of energy expenditure through p38 MAP
kinase activation of PPARgamma coactivator‐1. Mol Cell. 8, 971‐82.
Capítulo 1 Introducción Chapter 1 Introduction
152
Purushotham A, Schug TT, Xu Q, Surapureddi S, Guo X and Li X. (2009). Hepatocyte‐specific
deletion of Sirt1 alters fatty acid metabolism and results in hepatic steatosis and
inflammation. Cell Metab. 9, 327‐38.
Qiu X, Brown K, Hirschey MD, Verdin E and Chen D. (2010). Calorie restriction reduces
oxidative stress by Sirt3‐mediated Sod2 activation. Cell Metab. 12, 662‐7.
Qureshi K and Abrams GA. (2007). Metabolic liver disease of obesity and role of adipose
tissue in the pathogenesis of nonalcoholic fatty liver disease. World J Gastroenterol. 13,
3540‐53.
Radi R, Turrens JF, Chang LY, Bush KM, Crapo JD and Freeman BA. (1991). Detection of
catalase in rat heart mitochondria. J Biol Chem. 266, 22028‐34.
Raffaella C, Francesca B, Italia F, Marina P, Giovanna L and Susanna I. (2008). Alterations in
hepatic mitochondrial compartment in a model of obesity and insulin resistance. Obesity
(Silver Spring). 16, 958‐64.
Rahman ST, Merchant N, Haque T, Wahi J, Bhaheetharan S, Ferdinand KC and Khan BV.
(2011). The Impact of Lipoic Acid on Endothelial Function and Proteinuria in Quinapril‐
Treated Diabetic Patients With Stage I Hypertension: Results From the QUALITY Study. J
Cardiovasc Pharmacol Ther.
Ramsay RR, Gandour RD and van der Leij FR. (2001). Molecular enzymology of carnitine
transfer and transport. Biochim Biophys Acta. 1546, 21‐43.
Reddy JK and Rao MS. (2006). Lipid metabolism and liver inflammation. II. Fatty liver
disease and fatty acid oxidation. Am J Physiol Gastrointest Liver Physiol. 290, G852‐8.
Redinger RN. (2008). The prevalence and etiology of nongenetic obesity and associated
disorders. South Med J. 101, 395‐9.
Remington SJ. (1992). Structure and mechanism of citrate synthase. Curr Top Cell Regul. 33,
209‐29.
Renner K, Amberger A, Konwalinka G, Kofler R and Gnaiger E. (2003). Changes of
mitochondrial respiration, mitochondrial content and cell size after induction of
apoptosis in leukemia cells. Biochim Biophys Acta. 1642, 115‐23.
Ricquier D. (2005). Respiration uncoupling and metabolism in the control of energy
expenditure. Proc Nutr Soc. 64, 47‐52.
Rich PR and Marechal A. (2010). The mitochondrial respiratory chain. Essays Biochem. 47,
1‐23.
Chapter 1 Introduction Capítulo 1 Introducción
153
Ringel R, Sologub M, Morozov YI, Litonin D, Cramer P and Temiakov D. (2011). Structure of
human mitochondrial RNA polymerase. Nature.
Robb EL, Page MM, Wiens BE and Stuart JA. (2008a). Molecular mechanisms of oxidative
stress resistance induced by resveratrol: Specific and progressive induction of MnSOD.
Biochem Biophys Res Commun. 367, 406‐12.
Robb EL, Winkelmolen L, Visanji N, Brotchie J and Stuart JA. (2008b). Dietary resveratrol
administration increases MnSOD expression and activity in mouse brain. Biochem
Biophys Res Commun. 372, 254‐9.
Rocha‐Gonzalez HI, Ambriz‐Tututi M and Granados‐Soto V. (2008). Resveratrol: a natural
compound with pharmacological potential in neurodegenerative diseases. CNS Neurosci
Ther. 14, 234‐47.
Rodgers JT, Lerin C, Gerhart‐Hines Z and Puigserver P. (2008). Metabolic adaptations
through the PGC‐1 alpha and Sirt1 pathways. FEBS Lett. 582, 46‐53.
Rodgers JT, Lerin C, Haas W, Gygi SP, Spiegelman BM and Puigserver P. (2005). Nutrient
control of glucose homeostasis through a complex of PGC‐1alpha and Sirt1. Nature. 434,
113‐8.
Rodgers JT and Puigserver P. (2007). Fasting‐dependent glucose and lipid metabolic
response through hepatic sirtuin 1. Proc Natl Acad Sci U S A. 104, 12861‐6.
Rodrigo R, Guichard C and Charles R. (2007). Clinical pharmacology and therapeutic use of
antioxidant vitamins. Fundam Clin Pharmacol. 21, 111‐27.
Rodrigo R, Prat H, Passalacqua W, Araya J, Guichard C and Bachler JP. (2007). Relationship
between oxidative stress and essential hypertension. Hypertens Res. 30, 1159‐67.
Rogge MM. (2009). The role of impaired mitochondrial lipid oxidation in obesity. Biol Res
Nurs. 10, 356‐73.
Rogina B and Helfand SL. (2004). Sir2 mediates longevity in the fly through a pathway
related to calorie restriction. Proc Natl Acad Sci U S A. 101, 15998‐6003.
Rohas LM, St‐Pierre J, Uldry M, Jager S, Handschin C and Spiegelman BM. (2007). A
fundamental system of cellular energy homeostasis regulated by PGC‐1alpha. Proc Natl
Acad Sci U S A. 104, 7933‐8.
Rombouts K and Marra F. (2010). Molecular mechanisms of hepatic fibrosis in non‐alcoholic
steatohepatitis. Dig Dis. 28, 229‐35.
Rossi L, Mazzitelli S, Arciello M, Capo CR and Rotilio G. (2008). Benefits from dietary
polyphenols for brain aging and Alzheimer's disease. Neurochem Res. 33, 2390‐400.
Capítulo 1 Introducción Chapter 1 Introduction
154
Roussel D, Dumas JF, Simard G, Malthiery Y and Ritz P. (2004). Kinetics and control of
oxidative phosphorylation in rat liver mitochondria after dexamethasone treatment.
Biochem J. 382, 491‐9.
Rubinstein JL, Walker JE and Henderson R. (2003). Structure of the mitochondrial ATP
synthase by electron cryomicroscopy. EMBO J. 22, 6182‐92.
Rubio. (2007). Consenso SEEDO 2007 para la evaluación del sobrepeso y la obesidad y el
establecimiento de criterios de intervención terapéutica. Revista española de obesidad.
7‐48.
Ruderman NB, Xu XJ, Nelson L, Cacicedo JM, Saha AK, Lan F and Ido Y. (2010). AMPK and
Sirt1: a long‐standing partnership? Am J Physiol Endocrinol Metab. 298, E751‐60.
Rustin P, Munnich A and Rotig A. (2002). Succinate dehydrogenase and human diseases:
new insights into a well‐known enzyme. Eur J Hum Genet. 10, 289‐91.
Rutter J, Winge DR and Schiffman JD. (2010). Succinate dehydrogenase ‐ Assembly,
regulation and role in human disease. Mitochondrion. 10, 393‐401.
Ryan CK, Johnson LA, Germin BI and Marcos A. (2002). One hundred consecutive hepatic
biopsies in the workup of living donors for right lobe liver transplantation. Liver Transpl.
8, 1114‐22.
Sakamaki T, Casimiro MC, Ju X, Quong AA, Katiyar S, Liu M, Jiao X, Li A, Zhang X, Lu Y, Wang
C, Byers S, Nicholson R, Link T, Shemluck M, Yang J, Fricke ST, Novikoff PM, Papanikolaou
A, Arnold A, Albanese C and Pestell R. (2006). Cyclin D1 determines mitochondrial
function in vivo. Mol Cell Biol. 26, 5449‐69.
Salas‐Salvado J, Rubio MA, Barbany M and Moreno B. (2007). [SEEDO 2007 Consensus for
the evaluation of overweight and obesity and the establishment of therapeutic
intervention criteria]. Med Clin (Barc). 128, 184‐96; quiz 1 p following 200.
Salvi M, Battaglia V, Brunati AM, La Rocca N, Tibaldi E, Pietrangeli P, Marcocci L, Mondovi B,
Rossi CA and Toninello A. (2007). Catalase takes part in rat liver mitochondria oxidative
stress defense. J Biol Chem. 282, 24407‐15.
Sanyal AJ, Campbell‐Sargent C, Mirshahi F, Rizzo WB, Contos MJ, Sterling RK, Luketic VA,
Shiffman ML and Clore JN. (2001). Nonalcoholic steatohepatitis: association of insulin
resistance and mitochondrial abnormalities. Gastroenterology. 120, 1183‐92.
Sauve AA. (2009). Pharmaceutical strategies for activating sirtuins. Curr Pharm Des. 15, 45‐
56.
Chapter 1 Introduction Capítulo 1 Introducción
155
Scaglione R, Di Chiara T, Cariello T and Licata G. (2010). Visceral obesity and metabolic
syndrome: two faces of the same medal? Intern Emerg Med. 5, 111‐9.
Scarpulla RC. (2008a). Nuclear control of respiratory chain expression by nuclear respiratory
factors and PGC‐1‐related coactivator. Ann N Y Acad Sci. 1147, 321‐34.
Scarpulla RC. (2008b). Transcriptional paradigms in mammalian mitochondrial biogenesis
and function. Physiol Rev. 88, 611‐38.
Scarpulla RC. (2011). Metabolic control of mitochondrial biogenesis through the PGC‐1
family regulatory network. Biochim Biophys Acta. 1813, 1269‐78.
Scheffler IE 2008a. Biogenesis of mitochondria. Mitochondria. New Jersey: Wiley‐Liss.
Scheffler IE 2008b. Metabolic Pathways Inside Mitochondria. Mitochondria. New Jersey:
Wiley‐Liss.
Scheffler IE 2008c. Mitochondrial electron transfer and oxidative phosphorytaion. In:
WILEY‐LISS (ed.) Mitochondria. Second ed. Hoboken, New Jersey: John Wiley and Sons,
Inc., Publication.
Schellekens H, Dinan TG and Cryan JF. (2010). Lean mean fat reducing "ghrelin" machine:
hypothalamic ghrelin and ghrelin receptors as therapeutic targets in obesity.
Neuropharmacology. 58, 2‐16.
Scher MB, Vaquero A and Reinberg D. (2007). SirT3 is a nuclear NAD+‐dependent histone
deacetylase that translocates to the mitochondria upon cellular stress. Genes Dev. 21,
920‐8.
Scherag A, Jarick I, Grothe J, Biebermann H, Scherag S, Volckmar AL, Vogel CI, Greene B,
Hebebrand J and Hinney A. (2010). Investigation of a genome wide association signal for
obesity: synthetic association and haplotype analyses at the melanocortin 4 receptor
gene locus. PLoS ONE. 5, e13967.
Schindhelm RK, Diamant M, Dekker JM, Tushuizen ME, Teerlink T and Heine RJ. (2006).
Alanine aminotransferase as a marker of non‐alcoholic fatty liver disease in relation to
type 2 diabetes mellitus and cardiovascular disease. Diabetes Metab Res Rev. 22, 437‐
43.
Schlame M and Ren M. (2009). The role of cardiolipin in the structural organization of
mitochondrial membranes. Biochim Biophys Acta. 1788, 2080‐3.
Schlicker C, Gertz M, Papatheodorou P, Kachholz B, Becker CF and Steegborn C. (2008).
Substrates and regulation mechanisms for the human mitochondrial sirtuins Sirt3 and
Sirt5. J Mol Biol. 382, 790‐801.
Capítulo 1 Introducción Chapter 1 Introduction
156
Scholich H, Murphy ME and Sies H. (1989). Antioxidant activity of dihydrolipoate against
microsomal lipid peroxidation and its dependence on alpha‐tocopherol. Biochim Biophys
Acta. 1001, 256‐61.
Schrauzer GN. (2006). Interactive effects of selenium and chromium on mammary tumor
development and growth in MMTV‐infected female mice and their relevance to human
cancer. Biol Trace Elem Res. 109, 281‐92.
Schreiber SN, Emter R, Hock MB, Knutti D, Cardenas J, Podvinec M, Oakeley EJ and Kralli A.
(2004). The estrogen‐related receptor alpha (ERRalpha) functions in PPARgamma
coactivator 1alpha (PGC‐1alpha)‐induced mitochondrial biogenesis. Proc Natl Acad Sci U
S A. 101, 6472‐7.
Schug TT and Li X. (2011). Sirtuin 1 in lipid metabolism and obesity. Ann Med. 43, 198‐211.
Schupke H, Hempel R, Peter G, Hermann R, Wessel K, Engel J and Kronbach T. (2001). New
metabolic pathways of alpha‐lipoic acid. Drug Metab Dispos. 29, 855‐62.
Schwer B, North BJ, Frye RA, Ott M and Verdin E. (2002). The human silent information
regulator (Sir)2 homologue hSirt3 is a mitochondrial nicotinamide adenine dinucleotide‐
dependent deacetylase. J Cell Biol. 158, 647‐57.
Seelert H and Dencher NA. (2011). ATP synthase superassemblies in animals and plants:
two or more are better. Biochim Biophys Acta. 1807, 1185‐97.
Seki S, Kitada T, Yamada T, Sakaguchi H, Nakatani K and Wakasa K. (2002). In situ detection
of lipid peroxidation and oxidative DNA damage in non‐alcoholic fatty liver diseases. J
Hepatol. 37, 56‐62.
Selivanov VA, Votyakova TV, Pivtoraiko VN, Zeak J, Sukhomlin T, Trucco M, Roca J and
Cascante M. (2011). Reactive oxygen species production by forward and reverse
electron fluxes in the mitochondrial respiratory chain. PLoS Comput Biol. 7, e1001115.
Senen D, Adanali G, Ayhan M, Gorgu M and Erdogan B. (2002). Contribution of vitamin C
administration for increasing lipolysis. Aesthetic Plast Surg. 26, 123‐5.
Serrano Rios M, Ordovas JM and Gutierrez Fuentes JA (eds.) 2010. Obesity, Barcelona:
Elsevier.
Sesso HD, Buring JE, Christen WG, Kurth T, Belanger C, MacFadyen J, Bubes V, Manson JE,
Glynn RJ and Gaziano JM. (2008). Vitamins E and C in the prevention of cardiovascular
disease in men: the Physicians' Health Study II randomized controlled trial. Jama. 300,
2123‐33.
Chapter 1 Introduction Capítulo 1 Introducción
157
Shadel GS and Clayton DA. (1997). Mitochondrial DNA maintenance in vertebrates. Annu
Rev Biochem. 66, 409‐35.
Shao D, Liu Y, Liu X, Zhu L, Cui Y, Cui A, Qiao A, Kong X, Chen Q, Gupta N, Fang F and Chang
Y. (2010). PGC‐1 beta‐regulated mitochondrial biogenesis and function in myotubes is
mediated by NRF‐1 and ERR alpha. Mitochondrion. 10, 516‐27.
Sharoni Y, Danilenko M, Dubi N, Ben‐Dor A and Levy J. (2004). Carotenoids and
transcription. Arch Biochem Biophys. 430, 89‐96.
Shay KP, Moreau RF, Smith EJ, Smith AR and Hagen TM. (2009). Alpha‐lipoic acid as a
dietary supplement: molecular mechanisms and therapeutic potential. Biochim Biophys
Acta. 1790, 1149‐60.
Shekelle PG, Morton SC, Jungvig LK, Udani J, Spar M, Tu W, M JS, Coulter I, Newberry SJ and
Hardy M. (2004). Effect of supplemental vitamin E for the prevention and treatment of
cardiovascular disease. J Gen Intern Med. 19, 380‐9.
Sheline CT and Wei L. (2006). Free radical‐mediated neurotoxicity may be caused by
inhibition of mitochondrial dehydrogenases in vitro and in vivo. Neuroscience. 140, 235‐
46.
Shen W, Hao J, Feng Z, Tian C, Chen W, Packer L, Shi X, Zang W and Liu J. (2011). Lipoamide
or lipoic acid stimulates mitochondrial biogenesis in 3T3‐L1 adipocytes via the
endothelial NO synthase‐cGMP‐protein kinase G signalling pathway. Br J Pharmacol.
162, 1213‐24.
Shen W, Hao J, Tian C, Ren J, Yang L, Li X, Luo C, Cotma CW and Liu J. (2008a). A
combination of nutriments improves mitochondrial biogenesis and function in skeletal
muscle of type 2 diabetic Goto‐Kakizaki rats. PLoS ONE. 3, e2328.
Shen W, Liu K, Tian C, Yang L, Li X, Ren J, Packer L, Cotman CW and Liu J. (2008b). R‐alpha‐
lipoic acid and acetyl‐L‐carnitine complementarily promote mitochondrial biogenesis in
murine 3T3‐L1 adipocytes. Diabetologia. 51, 165‐74.
Shi T, Wang F, Stieren E and Tong Q. (2005). Sirt3, a mitochondrial sirtuin deacetylase,
regulates mitochondrial function and thermogenesis in brown adipocytes. J Biol Chem.
280, 13560‐7.
Silvester JA, Dickson VK, Runswick MJ, Leslie AG and Walker JE. (2006). The expression,
purification, crystallization and preliminary X‐ray analysis of a subcomplex of the
peripheral stalk of ATP synthase from bovine mitochondria. Acta Crystallogr Sect F Struct
Biol Cryst Commun. 62, 530‐3.
Capítulo 1 Introducción Chapter 1 Introduction
158
Sinclair DA and Guarente L. (1997). Extrachromosomal rDNA circles‐‐a cause of aging in
yeast. Cell. 91, 1033‐42.
Sinha A and Kling S. (2009). A review of adolescent obesity: prevalence, etiology, and
treatment. Obes Surg. 19, 113‐20.
Smith AR, Shenvi SV, Widlansky M, Suh JH and Hagen TM. (2004). Lipoic acid as a potential
therapy for chronic diseases associated with oxidative stress. Curr Med Chem. 11, 1135‐
46.
Smith BC, Settles B, Hallows WC, Craven MW and Denu JM. (2011). Sirt3 substrate
specificity determined by peptide arrays and machine learning. ACS Chem Biol. 6, 146‐
57.
Smith RA and Murphy MP. (2011). Mitochondria‐targeted antioxidants as therapies. Discov
Med. 11, 106‐14.
Smoly JM, Kuylenstierna B and Ernster L. (1970). Topological and functional organization of
the mitochondrion. Proc Natl Acad Sci U S A. 66, 125‐31.
Soleas GJ, Diamandis EP and Goldberg DM. (1997). Resveratrol: a molecule whose time has
come? And gone? Clin Biochem. 30, 91‐113.
Someya S and Prolla TA. (2010). Mitochondrial oxidative damage and apoptosis in age‐
related hearing loss. Mech Ageing Dev. 131, 480‐6.
Someya S, Yu W, Hallows WC, Xu J, Vann JM, Leeuwenburgh C, Tanokura M, Denu JM and
Prolla TA. (2010). Sirt3 mediates reduction of oxidative damage and prevention of age‐
related hearing loss under caloric restriction. Cell. 143, 802‐12.
Soobrattee MA, Bahorun T and Aruoma OI. (2006). Chemopreventive actions of
polyphenolic compounds in cancer. Biofactors. 27, 19‐35.
Sorensen DI, Devine MM and Rivers JM. (1974). Catabolism and tissue levels of ascorbic
acid following long‐term massive doses in the guinea pig. J Nutr. 104, 1041‐8.
Spiegelman BM. (2007). Transcriptional control of mitochondrial energy metabolism
through the PGC1 coactivators. Novartis Found Symp. 287, 60‐3; discussion 63‐9.
Spiteller G. (2003). Are lipid peroxidation processes induced by changes in the cell wall
structure and how are these processes connected with diseases? Med Hypotheses. 60,
69‐83.
St‐Pierre J, Lin J, Krauss S, Tarr PT, Yang R, Newgard CB and Spiegelman BM. (2003).
Bioenergetic analysis of peroxisome proliferator‐activated receptor gamma coactivators
Chapter 1 Introduction Capítulo 1 Introducción
159
1alpha and 1beta (PGC‐1alpha and PGC‐1beta) in muscle cells. J Biol Chem. 278, 26597‐
603.
St John JC, Facucho‐Oliveira J, Jiang Y, Kelly R and Salah R. (2010). Mitochondrial DNA
transmission, replication and inheritance: a journey from the gamete through the
embryo and into offspring and embryonic stem cells. Hum Reprod Update. 16, 488‐509.
Stadtman ER. (2004). Role of oxidant species in aging. Curr Med Chem. 11, 1105‐12.
Staiger H, Stefan N, Machicao F, Fritsche A and Haring HU. (2006). PPARGC1A mRNA levels
of in vitro differentiated human skeletal muscle cells are negatively associated with the
plasma oleate concentrations of the donors. Diabetologia. 49, 212‐4.
Steeves JA, Bassett DR, Jr., Thompson DL and Fitzhugh EC. (2011). Relationships of
occupational and non‐occupational physical activity to abdominal obesity. Int J Obes
(Lond).
Suh JH, Moreau R, Heath SH and Hagen TM. (2005). Dietary supplementation with (R)‐
alpha‐lipoic acid reverses the age‐related accumulation of iron and depletion of
antioxidants in the rat cerebral cortex. Redox Rep. 10, 52‐60.
Suh JH, Shenvi SV, Dixon BM, Liu H, Jaiswal AK, Liu RM and Hagen TM. (2004). Decline in
transcriptional activity of Nrf2 causes age‐related loss of glutathione synthesis, which is
reversible with lipoic acid. Proc Natl Acad Sci U S A. 101, 3381‐6.
Sun AY, Simonyi A and Sun GY. (2002). The "French Paradox" and beyond: neuroprotective
effects of polyphenols. Free Radic Biol Med. 32, 314‐8.
Sundaresan NR, Gupta M, Kim G, Rajamohan SB, Isbatan A and Gupta MP. (2009). Sirt3
blocks the cardiac hypertrophic response by augmenting Foxo3a‐dependent antioxidant
defense mechanisms in mice. J Clin Invest. 119, 2758‐71.
Sundaresan NR, Samant SA, Pillai VB, Rajamohan SB and Gupta MP. (2008). Sirt3 is a stress‐
responsive deacetylase in cardiomyocytes that protects cells from stress‐mediated cell
death by deacetylation of Ku70. Mol Cell Biol. 28, 6384‐401.
Sutherland WH, Manning PJ, Walker RJ, de Jong SA, Ryalls AR and Berry EA. (2007). Vitamin
E supplementation and plasma 8‐isoprostane and adiponectin in overweight subjects.
Obesity (Silver Spring). 15, 386‐91.
Suwa M, Nakano H, Radak Z and Kumagai S. (2011). Short‐term adenosine monophosphate‐
activated protein kinase activator 5‐aminoimidazole‐4‐carboxamide‐1‐beta‐D‐
ribofuranoside treatment increases the sirtuin 1 protein expression in skeletal muscle.
Metabolism. 60, 394‐403.
Capítulo 1 Introducción Chapter 1 Introduction
160
Tadolini B, Juliano C, Piu L, Franconi F and Cabrini L. (2000). Resveratrol inhibition of lipid
peroxidation. Free Radic Res. 33, 105‐14.
Taherzadeh‐Fard E, Saft C, Akkad DA, Wieczorek S, Haghikia A, Chan A, Epplen JT and Arning
L. (2011). PGC‐1alpha downstream transcription factors NRF‐1 and TFAM are genetic
modifiers of Huntington disease. Mol Neurodegener. 6, 32.
Tao R, Coleman MC, Pennington JD, Ozden O, Park SH, Jiang H, Kim HS, Flynn CR, Hill S,
Hayes McDonald W, Olivier AK, Spitz DR and Gius D. (2010). Sirt3‐mediated
deacetylation of evolutionarily conserved lysine 122 regulates MnSOD activity in
response to stress. Mol Cell. 40, 893‐904.
Tedesco L, Valerio A, Dossena M, Cardile A, Ragni M, Pagano C, Pagotto U, Carruba MO,
Vettor R and Nisoli E. (2010). Cannabinoid receptor stimulation impairs mitochondrial
biogenesis in mouse white adipose tissue, muscle, and liver: the role of eNOS, p38
MAPK, and AMPK pathways. Diabetes. 59, 2826‐36.
Teichert J, Hermann R, Ruus P and Preiss R. (2003). Plasma kinetics, metabolism, and
urinary excretion of alpha‐lipoic acid following oral administration in healthy volunteers.
J Clin Pharmacol. 43, 1257‐67.
Tolbert BM. (1985). Metabolism and function of ascorbic acid and its metabolites. Int J
Vitam Nutr Res Suppl. 27, 121‐38.
Tsukihara T, Aoyama H, Yamashita E, Tomizaki T, Yamaguchi H, Shinzawa‐Itoh K, Nakashima
R, Yaono R and Yoshikawa S. (1995). Structures of metal sites of oxidized bovine heart
cytochrome c oxidase at 2.8 A. Science. 269, 1069‐74.
Turrens JF, Alexandre A and Lehninger AL. (1985). Ubisemiquinone is the electron donor for
superoxide formation by complex III of heart mitochondria. Arch Biochem Biophys. 237,
408‐14.
Udenigwe CC, Ramprasath VR, Aluko RE and Jones PJ. (2008). Potential of resveratrol in
anticancer and anti‐inflammatory therapy. Nutr Rev. 66, 445‐54.
Ungvari Z, Orosz Z, Rivera A, Labinskyy N, Xiangmin Z, Olson S, Poldlutsky A and Csiszar A.
(2007). Resveratrol increases vascular oxidative stress resistance. Am J Phisiol Heart Circ
Physiol. 292, 2417‐2424.
Upston JM, Witting PK, Brown AJ, Stocker R and Keaney JF, Jr. (2001). Effect of vitamin E on
aortic lipid oxidation and intimal proliferation after arterial injury in cholesterol‐fed
rabbits. Free Radic Biol Med. 31, 1245‐53.
Chapter 1 Introduction Capítulo 1 Introducción
161
Vaisse C, Clement K, Guy‐Grand B and Froguel P. (1998). A frameshift mutation in human
MC4R is associated with a dominant form of obesity. Nat Genet. 20, 113‐4.
Valdecantos MP, Perez‐Matute P and Martinez JA. (2009). [Obesity and oxidative stress:
role of antioxidant supplementation]. Rev Invest Clin. 61, 127‐39.
Valsecchi F, Koopman WJ, Manjeri GR, Rodenburg RJ, Smeitink JA and Willems PH. (2010).
Complex I disorders: causes, mechanisms, and development of treatment strategies at
the cellular level. Dev Disabil Res Rev. 16, 175‐82.
Vanni E, Bugianesi E, Kotronen A, De Minicis S, Yki‐Jarvinen H and Svegliati‐Baroni G. (2010).
From the metabolic syndrome to NAFLD or vice versa? Dig Liver Dis. 42, 320‐30.
Vasquez‐Vivar J and Kalyanaraman B. (2000). Generation of superoxide from nitric oxide
synthase. FEBS Lett. 481, 305‐6.
Vasquez‐Vivar J, Kalyanaraman B, Martasek P, Hogg N, Masters BS, Karoui H, Tordo P and
Pritchard KA, Jr. (1998). Superoxide generation by endothelial nitric oxide synthase: the
influence of cofactors. Proc Natl Acad Sci U S A. 95, 9220‐5.
Vendelbo MH and Nair KS. (2011). Mitochondrial longevity pathways. Biochim Biophys Acta.
1813, 634‐44.
Vercauteren K, Gleyzer N and Scarpulla RC. (2008). PGC‐1‐related coactivator complexes
with HCF‐1 and NRF‐2beta in mediating NRF‐2(GABP)‐dependent respiratory gene
expression. J Biol Chem. 283, 12102‐11.
Verdin E, Hirschey MD, Finley LW and Haigis MC. (2010). Sirtuin regulation of mitochondria:
energy production, apoptosis, and signaling. Trends Biochem Sci. 35, 669‐75.
Vignais PV. (2002). The superoxide‐generating NADPH oxidase: structural aspects and
activation mechanism. Cell Mol Life Sci. 59, 1428‐59.
Vina J, Gomez‐Cabrera MC, Borras C, Froio T, Sanchis‐Gomar F, Martinez‐Bello VE and
Pallardo FV. (2009). Mitochondrial biogenesis in exercise and in ageing. Adv Drug Deliv
Rev. 61, 1369‐74.
Vincent HK, Bourguignon CM, Vincent KR, Weltman AL, Bryant M and Taylor AG. (2006).
Antioxidant supplementation lowers exercise‐induced oxidative stress in young
overweight adults. Obesity (Silver Spring). 14, 2224‐35.
Vincent HK, Innes KE and Vincent KR. (2007). Oxidative stress and potential interventions to
reduce oxidative stress in overweight and obesity. Diabetes Obes Metab. 9, 813‐39.
Vinogradov AD. (2008). NADH/NAD+ interaction with NADH: ubiquinone oxidoreductase
(complex I). Biochim Biophys Acta. 1777, 729‐34.
Capítulo 1 Introducción Chapter 1 Introduction
162
Viola HM and Hool LC. (2010). Qo site of mitochondrial complex III is the source of
increased superoxide after transient exposure to hydrogen peroxide. J Mol Cell Cardiol.
49, 875‐85.
Voet D, Voet J.G. (2006). Bioquímica. Buenos Aires: Editorial medica panamericana.
Walker AK, Yang F, Jiang K, Ji JY, Watts JL, Purushotham A, Boss O, Hirsch ML, Ribich S,
Smith JJ, Israelian K, Westphal CH, Rodgers JT, Shioda T, Elson SL, Mulligan P, Najafi‐
Shoushtari H, Black JC, Thakur JK, Kadyk LC, Whetstine JR, Mostoslavsky R, Puigserver P,
Li X, Dyson NJ, Hart AC and Naar AM. (2010). Conserved role of Sirt1 orthologs in fasting‐
dependent inhibition of the lipid/cholesterol regulator SREBP. Genes Dev. 24, 1403‐17.
Walker JE and Dickson VK. (2006). The peripheral stalk of the mitochondrial ATP synthase.
Biochim Biophys Acta. 1757, 286‐96.
Wang C, Li Z, Lu Y, Du R, Katiyar S, Yang J, Fu M, Leader JE, Quong A, Novikoff PM and
Pestell RG. (2006). Cyclin D1 repression of nuclear respiratory factor 1 integrates nuclear
DNA synthesis and mitochondrial function. Proc Natl Acad Sci U S A. 103, 11567‐72.
Wang D, Ma J, Zhang S, Hinney A, Hebebrand J, Wang Y and Wang HJ. (2010a). Association
of the MC4R V103I polymorphism with obesity: a Chinese case‐control study and meta‐
analysis in 55,195 individuals. Obesity (Silver Spring). 18, 573‐9.
Wang Y, Li X, Guo Y, Chan L and Guan X. (2010b). alpha‐Lipoic acid increases energy
expenditure by enhancing adenosine monophosphate‐activated protein kinase‐
peroxisome proliferator‐activated receptor‐gamma coactivator‐1alpha signaling in the
skeletal muscle of aged mice. Metabolism. 59, 967‐76.
Weghuber D, Roden M, Franz C, Chmelik M, Torabia S, Nowotny P, Gruber S, Waldhausl W,
Klingler A, Bieglmayer C, Bischof M, Wolzt M, Schaller G and Widhalm K. (2011). Vascular
function in obese children with non‐alcoholic fatty liver disease. Int J Pediatr Obes. 6,
120‐7.
Wei YH, Wu SB, Ma YS and Lee HC. (2009). Respiratory function decline and DNA mutation
in mitochondria, oxidative stress and altered gene expression during aging. Chang Gung
Med J. 32, 113‐32.
Widhalm K and Ghods E. (2010). Nonalcoholic fatty liver disease: a challenge for
pediatricians. Int J Obes (Lond). 34, 1451‐67.
Wiedmer P, Nogueiras R, Broglio F, D'Alessio D and Tschop MH. (2007). Ghrelin, obesity and
diabetes. Nat Clin Pract Endocrinol Metab. 3, 705‐12.
Chapter 1 Introduction Capítulo 1 Introducción
163
Wiegand G and Remington SJ. (1986). Citrate synthase: structure, control, and mechanism.
Annu Rev Biophys Biophys Chem. 15, 97‐117.
Wilson JX. (2002a). Bioavailability of oxidized vitamin C (dehydroascorbic acid). J Am Diet
Assoc. 102, 1222; author reply 1224‐5.
Wilson JX. (2002b). The physiological role of dehydroascorbic acid. FEBS Lett. 527, 5‐9.
Williamson JR and Cooper RH. (1980). Regulation of the citric acid cycle in mammalian
systems. FEBS Lett. 117 Suppl, K73‐85.
Wintergerst ES, Maggini S and Hornig DH. (2007). Contribution of selected vitamins and
trace elements to immune function. Ann Nutr Metab. 51, 301‐23.
Wittig I and Schagger H. (2009). Supramolecular organization of ATP synthase and
respiratory chain in mitochondrial membranes. Biochim Biophys Acta. 1787, 672‐80.
Wittwer J and Hersberger M. (2007). The two faces of the 15‐lipoxygenase in
atherosclerosis. Prostaglandins Leukot Essent Fatty Acids. 77, 67‐77.
Wolfrum C and Stoffel M. (2006). Coactivation of Foxa2 through Pgc‐1beta promotes liver
fatty acid oxidation and triglyceride/VLDL secretion. Cell Metab. 3, 99‐110.
Wong‐Riley MT, Liang HL, Eells JT, Chance B, Henry MM, Buchmann E, Kane M and Whelan
HT. (2005). Photobiomodulation directly benefits primary neurons functionally
inactivated by toxins: role of cytochrome c oxidase. J Biol Chem. 280, 4761‐71.
Yadav V, Marracci GH, Munar MY, Cherala G, Stuber LE, Alvarez L, Shinto L, Koop DR and
Bourdette DN. (2010). Pharmacokinetic study of lipoic acid in multiple sclerosis:
comparing mice and human pharmacokinetic parameters. Mult Scler. 16, 387‐97.
Yang T and Sauve AA. (2006). NAD metabolism and sirtuins: metabolic regulation of protein
deacetylation in stress and toxicity. Aaps J. 8, E632‐43.
Yankovskaya V, Horsefield R, Tornroth S, Luna‐Chavez C, Miyoshi H, Leger C, Byrne B,
Cecchini G and Iwata S. (2003). Architecture of succinate dehydrogenase and reactive
oxygen species generation. Science. 299, 700‐4.
Yeo GS, Lank EJ, Farooqi IS, Keogh J, Challis BG and O'Rahilly S. (2003). Mutations in the
human melanocortin‐4 receptor gene associated with severe familial obesity disrupts
receptor function through multiple molecular mechanisms. Hum Mol Genet. 12, 561‐74.
Yi X, Nickeleit V, James LR and Maeda N. (2011). alpha‐Lipoic acid protects diabetic
apolipoprotein E‐deficient mice from nephropathy. J Diabetes Complications. 25, 193‐
201.
Capítulo 1 Introducción Chapter 1 Introduction
164
Yi X, Xu L, Kim K, Kim HS and Maeda N. (2010). Genetic reduction of lipoic acid synthase
expression modestly increases atherosclerosis in male, but not in female, apolipoprotein
E‐deficient mice. Atherosclerosis. 211, 424‐30.
Ying Z, Kherada N, Farrar B, Kampfrath T, Chung Y, Simonetti O, Deiuliis J, Desikan R, Khan B,
Villamena F, Sun Q, Parthasarathy S and Rajagopalan S. (2010). Lipoic acid effects on
established atherosclerosis. Life Sci. 86, 95‐102.
Yoshida Y, Izumi H, Torigoe T, Ishiguchi H, Itoh H, Kang D and Kohno K. (2003). P53
physically interacts with mitochondrial transcription factor A and differentially regulates
binding to damaged DNA. Cancer Res. 63, 3729‐34.
Yoshikawa S, Muramoto K and Shinzawa‐Itoh K. (2011a). The O(2) reduction and proton
pumping gate mechanism of bovine heart cytochrome c oxidase. Biochim Biophys Acta.
1807, 1279‐86.
Yoshikawa S, Muramoto K and Shinzawa‐Itoh K. (2011b). Proton‐pumping mechanism of
cytochrome C oxidase. Annu Rev Biophys. 40, 205‐23.
Youssef WI and McCullough AJ. (2002). Steatohepatitis in obese individuals. Best Pract Res
Clin Gastroenterol. 16, 733‐47.
Yu BP. (1994). Cellular defenses against damage from reactive oxygen species. Physiol Rev.
74, 139‐62.
Yu BP and Chung HY. (2006). Adaptive mechanisms to oxidative stress during aging. Mech
Ageing Dev. 127, 436‐43.
Yu MA, Egawa T, Shinzawa‐Itoh K, Yoshikawa S, Yeh SR, Rousseau DL and Gerfen GJ. (2011).
Radical formation in cytochrome c oxidase. Biochim Biophys Acta. 1807, 1295‐304.
Zafra‐Stone S, Yasmin T, Bagchi M, Chatterjee A, Vinson JA and Bagchi D. (2007). Berry
anthocyanins as novel antioxidants in human health and disease prevention. Mol Nutr
Food Res. 51, 675‐83.
Zangar RC, Davydov DR and Verma S. (2004). Mechanisms that regulate production of
reactive oxygen species by cytochrome P450. Toxicol Appl Pharmacol. 199, 316‐31.
Zelman S. (1952). The liver in obesity. AMA Arch Intern Med. 90, 141‐56.
Zhang H, Jia H, Liu J, Ao N, Yan B, Shen W, Wang X, Li X and Luo C. (2010). Combined R‐
alpha‐lipoic acid and acetyl‐L‐carnitine exerts efficient preventative effects in a cellular
model of Parkinson's disease. J Cell Mol Med. 14, 215‐25.
Chapter 1 Introduction Capítulo 1 Introducción
165
Zhang H, Maguire DJ, Zhang M, Zhang L and Okunieff P. (2011a). Elevated mitochondrial
DNA copy number and POL‐gamma expression but decreased expression of TFAM in
murine intestine following therapeutic dose irradiation. Adv Exp Med Biol. 701, 201‐6.
Zhang HM, Zhang Y and Zhang BX. (2011). The role of mitochondrial complex III in
melatonin‐induced ROS production in cultured mesangial cells. J Pineal Res. 50, 78‐82.
Zhang T, Berrocal JG, Frizzell KM, Gamble MJ, DuMond ME, Krishnakumar R, Yang T, Sauve
AA and Kraus WL. (2009). Enzymes in the NAD+ salvage pathway regulate Sirt1 activity at
target gene promoters. J Biol Chem. 284, 20408‐17.
Zhang WJ, Bird KE, McMillen TS, LeBoeuf RC, Hagen TM and Frei B. (2008). Dietary alpha‐
lipoic acid supplementation inhibits atherosclerotic lesion development in
apolipoprotein E‐deficient and apolipoprotein E/low‐density lipoprotein receptor‐
deficient mice. Circulation. 117, 421‐8.
Zhang Y, Han P, Wu N, He B, Lu Y, Li S, Liu Y, Zhao S, Liu L and Li Y. (2011b). Amelioration of
lipid abnormalities by alpha‐lipoic acid through antioxidative and anti‐inflammatory
effects. Obesity (Silver Spring). 19, 1647‐53.
Zini R, Morin C, Bertelli A, Bertelli AA and Tillement JP. (1999). Effects of resveratrol on the
rat brain respiratory chain. Drugs Exp Clin Res. 25, 87‐97.
CAPÍTULO 2/CHAPTER 2
Hipótesis y Objetivos/Hypothesis and
aims
Chapter 2 Hypothesis and aims Capítulo 2 Hipótesis y Objetivos
169
HIPOTÉSIS Y OBJETIVOS
El hígado constituye uno de los órganos centrales en el control del metabolismo
mediante la regulación de la homeostasis energética. Además, este es órgano es el
modulador del flujo de nutrientes procedentes de la dieta hacia el resto del organismo a
través de la circulación portal. Por todo ello, el fallo hepático tiene importantes
repercusiones en el metabolismo sistémico. En este sentido, las principales causas de
patología hepática son la hepatopatía alcohólica, la hepatitis C y la enfermedad hepática
no alcohólica (NAFLD). En relación a su etiología, numerosos autores han determinado el
síndrome metabólico como la principal causa de NAFLD, considerándose como la
principal complicación de la obesidad a nivel hepático y siendo la principal causa de
hepatopatía en países occidentales (Francque et al 2011; Guajardo‐Salinas and Hilmy
2010).
Dentro de la enfermedad hepática no alcohólica, la esteatosis hepática se ha
considerado históricamente una condición benigna, reversible, asintomática y con pocas
complicaciones clínicas; sin embargo, la silente progresión a esteatohepatitis no
alcohólica (NASH) constituye un paso crítico con consecuencias graves e irreversibles
que incluyen la fibrosis, la cirrosis y el cáncer (Rombouts et al 2010; Qureshi and Abrams
2007; Day 2006; Cortez‐Pinto et al 2006), por lo que es de radical importancia controlar
los factores implicados en ésta evolución. En este sentido, la disfunción mitocondrial y
estrés oxidativo han sido descritos como dos factores claves en la evolución de la NAFLD
(Day et al 2002).
La relación de ambos factores ha sido ampliamente estudiada en los últimos años. Así, la
mitocondria ha sido descrita como la principal fuente de generación de especies
reactivas de oxígeno (ROS). En este sentido, aunque este orgánulo cuenta con potentes
sistemas de defensa frente al estrés oxidativo, también puede ser diana del aumento de
ROS cuya reacción con las estructuras mitocondriales induce daño oxidativo en las
mismas (Smith et al 2011, Someya et al 2010). Por todo ello, numerosos estudios han
analizado el papel de este orgánulo en patologías que cursan con un aumento del estrés
oxidativo y su potencial papel como diana terapéutica de estas enfermedades (Li et al
2010; Liu et al 2011; Müller et al 2010; Marra et al 2010).
Capítulo 2 Hipótesis y Objetivos Chapter 2 Hypothesis and aims
170
Por otra parte, el uso de antioxidantes en el campo clínico para el tratamiento y la
prevención de la obesidad (Savory et al 2011; Arias et al 2011; Vincent et al 2009) y la
NAFLD (McCarthy et al 2011; Samy et al 2011; Tauriaienen et al 2011) ha cobrado
especial relevancia en los últimos años. En este sentido, uno de las moléculas más
estudiadas es el ácido lipoico (AL) no sólo por sus importantes propiedades
antioxidantes sino también por su papel como regulador metabólico y nutriente
mitocondrial. Aunque su papel anti‐obesogénico ha sido descrito en algunas
investigaciones previas (Carbonelly et al 2011; Koh et al 2011; Wang et al 2011; Prieto
Hontora et al 2009); sin embargo, existen pocos estudios que analicen directamente el
papel de la suplementación con AL para el tratamiento y/o la prevención de la esteatosis
hepática (Park et al 2008; Huong et al 2008).
Por todo ello, la hipótesis de partida de la presente investigación es que que el
tratamiento con antioxidantes, en especial la suplementación de la dieta con ácido
lipoico, puede modular el estrés oxidativo y la función mitocondrial en el hígado,
previniendo el desarrolló de esteatosis hepática y su evolución a esteatohepatitis.
Así, los objetivos específicos de esta tesis doctoral fueron:
1. Analizar y comparar el papel de diferentes antioxidantes de la dieta: ácido lipoico,
vitamina C y resveratrol sobre diversos marcadores característicos de la funcionalidad
mitocondrial y el estrés oxidativo en extractos mitocondriales de hígado de rata.
2. Determinar el potencial papel de las defensas antioxidantes eritrocitarias como
marcadores del estado oxidativo del compartimento hepático mitocondrial en
diferentes situaciones de balance oxidativo, como la ingesta de una dieta alta en grasa
(balance pro‐oxidante) y la suplementación con ácido lipoico (balance anti‐oxidante).
Chapter 2 Hypothesis and aims Capítulo 2 Hipótesis y Objetivos
171
3. Analizar el efecto de la suplementación con ácido lipoico de una dieta alta en grasa
en la prevención y el desarrolló de NAFLD. Además, determinar la capacidad de este
antioxidante para modular la homeostasis energética mitocondrial a nivel hepático.
4. Investigar las potenciales acciones beneficiosas del ácido lipoico sobre el estrés
oxidativo mitocondrial asociado a la NAFLD inducida por una dieta alta en grasa y el
papel de las sirtuinas en dichos efectos.
Capítulo 2 Hipótesis y Objetivos Chapter 2 Hypothesis and aims
172
HYPOTHESIS AND AIMS
The liver is a central organ in the control of metabolism through the regulation of energy
homeostasis. Moreover, this organ is the main modulator of nutrients flux from the diet
to the whole body by the hepatic portal system. Consequently, hepatic failure has
important consequences in metabolism. In this sense, alcoholic steatohepatitis,
Hepatitis C and non alcoholic fatty liver disease (NAFLD) are the main causes of liver
dysfunction. Regarding to the aetiology of NAFLD, metabolic syndrome are the main
causes of this pathology. In fact, several studies have described that NAFLD is the
hepatic representation of obesity and is the major cause of liver injure in western
countries (Francque et al 2011; Guajardo‐Salinas and Hilmy 2010).
In this context, hepatic steatosis has been historically considered a benign, reversible,
asymptomatic with few clinical complications, but the silent progression to
steatohepatitis (NASH) is a critical step with serious and irreversible consequences
including fibrosis, cirrhosis and cancer (Rombouts et al 2010, Qureshi and Abrams 2007;
Day 2006, Cortez‐Pinto et al 2006). Therefore, the control of the factors involved in this
evolution is of utmost importance. In this regard, mitochondrial dysfunction and
oxidative stress have been described as two key factors in the development of NAFLD
(Day et al 2002).
The relationship between mitochondrial dysfunction and oxidative stress has been
deeply analyzed in last years. In this sense, several studies have been established that
mitochondria are the major site of reactive oxygen species production. In this sense,
although this organelle has strong antioxidant defenses against oxidative stress, it may
also be a target of ROS which, in turn, could damage mitochondrial structure (Smith et al
2011, Someya et al 2010). Therefore, the role of mitochondrial dysfunction in the
development of some diseases linked to increased oxidative stress has been deeply
analyzed. Moreover, recent investigations have established that the mitochondrion is a
potential target for the treatment of these pathologies (Li et al 2010, Liu et al 2011,
Müller et al 2010, Marra et al 2010).
Chapter 2 Hypothesis and aims Capítulo 2 Hipótesis y Objetivos
173
On the other hand, the use of antioxidants in the clinical field for treatment and
prevention of obesity (Savory et al 2011, Arias et al 2011, Vincent et al 2009) and NAFLD
(McCarthy et al 2011; Samy et al 2011; Tauriaienen et al 2011) have gained special
significance in recent years. In this sense, lipoic acid has been one of the most studied
molecules. Interestingly, its potential beneficial effects are not only due to their strong
antioxidant properties, but also due to its role as a mitochondrial nutrient. Thus, the
anti‐obesogenic effect of LA has been described in numerous studies (Carbonelly et al
2011, Koh et al 2011, Wang et al 2011; Prieto Hontoria et al 2009). However, there are
few studies looking directly into LA supplementation as a treatment or prevention for
hepatic steatosis (Park et al 2008; Huong et al 2008).
Therefore the hypothesis of this investigation is that the antioxidant treatment,
especially supplementation with lipoic acid, modifies the oxidative stress and
mitochondrial function in the liver, preventing the development of hepatic steatosis and
its progression to steatohepatitis.
Thus, the specific aims of the present work were:
1. To analyze and compare the effects of different dietary antioxidants: lipoic acid,
vitamin C and resveratrol, in different markers of mitochondrial function and oxidative
stress in isolated rat liver mitochondria.
2. To determine the potential role of erythrocyte antioxidant defenses as biomarkers of
oxidative status in hepatic mitochondrial compartment under different oxidative
conditions, such as, high fat diet intake (pro‐oxidant status) and lipoic acid
supplementation (anti‐oxidant status).
Capítulo 2 Hipótesis y Objetivos Chapter 2 Hypothesis and aims
174
3. To test the effect of lipoic acid supplementation of high‐fat diet in the prevention and
the development of NAFLD. Moreover, to investigate the ability of this antioxidant to
modulate mitochondrial energy homeostasis in the liver.
4. To study the potential beneficial effects of LA on mitochondrial oxidative stress
associated to NAFLD induced by a HFD and the mechanistic role of sirtuins on these
effects.
CAPÍTULO 3/CHAPTER 3
Material y Métodos/Material and
Methods
Chapter 3 Material and Methods Capitulo 3 Material y Métodos
177
Ilustración 35 Resumen de módelos
experimentales empleados y
determinaciones realizadas
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
178
Ilustración 35 b Summary of
experimental dessign
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
179
3.1 ESTUDIO IN VITRO
3.1.1 DISEÑO EXPERIMENTAL
El diseño del presente estudio, ha sido orientado para evaluar el efecto directo de tres
antioxidantes de la dieta sobre la producción mitocondrial de ROS, la actividad de las
principales enzimas antioxidantes mitocondriales y varios macadores respiratorios en
extractos mitocondriales de hígado de rata.
Ilustración 36 Diseño experimental in vitro
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
180
3.1.2 MODELO ANIMAL
Este estudio se realizó en ratas (Rattus Norvergicus) Wistar macho (n=8) de 12 semanas
de edad, suministradas por el Centro de Investigacion en Farmacobiología Aplicada
(CIFA, Universidad de Navarra, Pamplona, España). Los animales se mantuvieron en
jaulas de poli‐propileno de 19 x 43 x 26 cm provistas de una rejilla de acero inoxidable
(tres‐cuatro animales por jaula) bajo condiciones controladas de luz con ciclos de 12 h
de luz/oscuridad, una temperatura de 22 ± 2ºC y humedad relativa de 55 ± 10%. Todos
los animales fueron alimentados con una dieta estándar suministrada por Harlam Ibérica
(Barcelona, España), cuyas características nutricionales se recogen en la Tabla 2:
Tabla 2 Composición nutricional de la dieta
% VCT
Energía (Kcal) 310
Proteínas (g/100 g pellet) 12,9 16,6 %
Lípidos (g/100 g pellet) 1,6 4,6 %
Carbohidratos (g/100 g pellet) 60,9 78,6 %
%VCT: porcentaje del valor calórico total de la dieta
Los animales tuvieron acceso a la comida y la bebida ad libitum hasta el día antes del
sacrificio cuando se mantuvieron en ayuno durante un periodo aproximado de 12 h.
Antes del sacrificio fueron pesados (281,6±3,76 g). Posteriormente, cada animal fue
sacrificado por decapitación e inmediatamente se extrajo el hígado. Todos los
procedimientos realizados en este ensayo fueron realizados con la aprobación del
Comité de Ética para la Experimentación Animal (CEEA) de la Universidad de Navarra.
3.1.3 AISLAMIENTO DE MITOCONDRIAS DE HÍGADO DE RATA POR SEDIMENTACIÓN
3.1.3.1 Fundamento básico
La base experimental del aislamiento de mitocondrias se fundamenta en la separación
por sedimentación en función del peso de los diferentes orgánulos celulares. En primer
lugar se rompe la membrana celular mediante homogeneización manteniendo la
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
181
estructura mitocondrial íntegra. Seguidamente la fracción mitocondrial se aísla de otros
orgánulos y restos celulares por sedimentación a diferentes velocidades en función de
su tamaño.
3.1.3.2 Reactivos
Medio 1 (pH 7,4)
Sacarosa desionizada 250 mM
NaTes (pH 7,4) 5 mM
EDTA 1 mM
Agua ultrapura
Medio 2 (pH 7,4)
Sacarosa desionizada 250 mM
NaTes (pH 7,4) 5 mM
BSA 99% 5 mg/ml
Agua ultrapura
3.1.3.3 Materiales y equipos
Homogeneizador Potter Elvhejem (BRAUN)
Tubo de vidrio y pistilo para el homogeneizador
Centrifuga RC 28 S (Sorwall)
Rotor SS‐34 (Sorwall)
Adaptadores para rotor SS‐34 (Sorwall)
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
182
3.1.3.4 Procedimiento
Inmediatamente después del sacrificio se extrajeron los hígados (Ilustración 37.a), se
retiraron las partes visible de tejido conectivo (Ilustración 37.b), se lavaron en medio 1
pre‐enfriado y se mantuvieron en el mismo medio (10ml/g tejido) a 4oC hasta la
inmediata obtención de los extractos mitocondriales.
Ilustración 37 Imagen de la cavidad abdominal de rata Wistar (a) y partes del hígado (b)
Primero se cortó el tejido cuidadosamente con tijeras dentro del medio 1. A
continuación se homogeneizó en un homogeneizador Potter Elvhejem (6/8 ciclos de 10
segundos). El homogeneizado resultante se centrifugó a 3000 g durante 10 minutos a
4oC (1), el sedimento constituido por núcleos y restos celulares se desechó. Con el
sobrenadante se realizó una centrifugación a 14500 g durante 10 minutos a 4oC (2), se
desechó el sobrenadante. El nuevo sedimento está formado por el extracto mitocondrial
que puede hallarse contaminado por restos de otros orgánulos. Para proceder a la
purificación del sedimento mitocondrial fue resuspendido con pipeta en medio 2 (2/5
del volumen inicial) y se repitieron los pasos 1 y 2 obteniendo un precipitado purificado
constituido por la fracción mitocondrial. Este precipitado se resuspendió con pipeta en
medio 2 (0,5 ml/g de tejido inicial). Todas las operaciones descritas en el transcurso del
aislamiento se realizaron a 4oC y con material libre de jabones (Ilustración 38)
(Gonzalez‐Muniesa et al 2006).
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
183
Ilustración 38 Protocolo de aislamiento de extractos mitocondriales de hígado de rata
Posteriormente, se distribuyó la muestra en alícuotas para las distintas determinaciones.
Después de ensayar diferentes condiciones de congelación y descongelación, se observó
que estos parámetros no afectaban a las determinaciones posteriores, salvo en el caso
de los parámetros respiratorios y la producción de ROS, por lo que estas
determinaciones se realizaron en extractos frescos. Para el resto de determinaciones, las
alícuotas se congelaron inmediatamente en nitrógeno líquido y se conservaron a ‐80oC.
La descongelación se llevó a cabo de forma lenta a 4oC.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
184
3.1.4 TRATAMIENTO CON ANTIOXIDANTES
3.1.4.1 Fundamento básico
El método se fundamenta en la exposición de mitocondrias aisladas de hígado de rata
(MAHR) a diferentes antioxidantes para comprobar el efecto directo de los mismos
sobre la funcionalidad mitocondrial.
3.1.4.2 Reactivos
Medio respiratorio (pH 7,4) (Shen et al 2008)
Sacarosa desionizada 70 mM
Manitol 250 mM
KH2PO4 2,5 mM
MgCl2 2,5 mM
EDTA 0,5 mM
Hepes 2 mM
BSA (99 %) 0,1% (p:v)
Agua ultrapura
Antioxidantes empleados
Tabla 3 Condiciones de utilización de los antioxidantes empleados
Vitamina C Resveratrol Ác. Lipoico
Concentración stock 0,24 mM 0,4 mM 0,24 mM
Concentración MAHR 30 µM 50 µM 30 µM
Conservación Fresco ‐20ºC/oscuridad ‐20ºC/oscuridad
Diluciones seriadas 2 2 2
Diluyente inicial Agua ultrapura Etanol (99%) Etanol (99%)
Diluyente d. seriadas Agua ultrapura Agua ultrapura Agua ultrapura
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
185
3.1.4.3 Material y equipos
Baño húmedo termostatizado con agitación
Tubos de centelleo
3.1.4.4 Procedimiento
Las muestras fueron descongeladas a 4oC, salvo en el caso de la medición de parámetros
respiratorios y producción de ROS que se emplearon extractos mitocondriales frescos tal
y como se ha comentado anteriormente. A continuación, se diluyeron en medio
respiratorio a 4oC hasta la concentración deseada, se distribuyeron en alícuotas en tubos
de centelleo y se les añadió el antioxidante. Inmediatamente después, los tubos se
cerraron y se sellaron. Se incubaron en un baño húmedo con control de temperatura a
25oC con agitación durante 30 y 60 minutos. Para discriminar el posible efecto del
tiempo y la temperatura sobre las MAHR, se realizó de forma paralela y bajo las mismas
condiciones experimentales la incubación de MAHR con la cantidad equivalente de
etanol a la existente en las diluciones de RSV y AL en vez de cada antioxidante. De tal
manera que cada tiempo tiene su propio control, sometido a las mismas condiciones,
respecto al cual se comparan todas las determinaciones.
3.1.5 DETERMINACIÓN DE LA PRODUCCIÓN DE ANIÓN SUPERÓXIDO POR
QUIMIOLUMINISCENCIA
3.1.5.1 Fundamento básico
Esta técnica de medida se basa en la emisión de radiación electromagnética producida
por una reacción química. En el proceso de quimiolumuniscencia directa, dos reactivos,
un substrato y un oxidante, reaccionan para formar un producto intermedio de la
reacción que pasa a un estado electrónicamente excitado, para relajarse a continuación
hasta el estado fundamental con emisión de un fotón, responsable de la emisión de luz
(Garcia‐Campaña et al 2001). Para la detección del O2*‐ se utilizó como reactivo la
lucigenina por su especifidad y su alta sensibilidad en la detección de esta especie
reactiva (Ilustración 39) (Okajima and Ohsaka 2003).
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
186
Ilustración 39 Esquema de la reacción de quimioluminiscencia para la determinación de
anión superóxido.
3.1.5.2 Reactivos
Lucigenina 0,5 mM
Succinato 40 mM
Medio Respiratorio
3.1.5.3 Material y equipos
Agitador orbital de placas
Luminoskan Ascent (Thermolab System)
Placas blancas de 96 pocillos
3.1.5.4 Procedimiento
Para la determinación de O2*‐ antes de la incubación se diluyeron las muestras en medio
respiratorio hasta alcanzar una concentración de 0,5 mg/ml y posteriormente se
incubaron con los diferentes antioxidantes. Al final de los periodos de incubación se
determinó la cinética de producción estimulada por succinato (5 mM por pocillo)
durante 90 minutos, tras la adición de lucigenina a una concentración por pocillo de 5
µM. Estudios previos han descrito que concentraciones iguales o superiores a 50 µM
pueden introducir un sesgo en la medida de la producción de O2*‐ por activación de
ciclos redox (Li et al 1999, Li, Zhu and Trush 1999), debido a esto la concentración
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
187
empleada en nuestro estudio fue diez veces menor para prevenir este error de medida.
La concentración de proteína por pocillo fue de 0,1 mg/pocillo (Ilustración 40). Todas las
determinaciones se realizaron por triplicado.
Ilustración 40 Esquema del procedimiento para la determinación de la producción de
anión superóxido
3.1.6 DETERMINACIÓN DE LA PRODUCCIÓN DE HIDROPERÓXIDOS POR
QUIMIOLUMINISCENCIA
3.1.6.1 Fundamento básico
Se basa en el mismo fundamento que la medida de O2*‐ pero con diferente reactivo: el
luminol (Ilustración 41).
Ilustración 41 Esquema de la reacción para la determinación de hidroperóxidos
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
188
3.1.6.2 Reactivos
Luminol 0,25 mM
Peroxidasa de rábano (HRP) 10 µg/ml
Succinato 5 mM
Medio Respiratorio
3.1.6.3 Material y equipos
Agitador orbital de placas
Luminoskan Ascent (Thermolab System)
Placas de luminiscencia de 96 pocillo
3.1.6.4 Procedimiento
Para la determinación de H2O2, antes de la incubación se diluyeron las muestras en
medio 3 hasta alcanzar una concentración de 0,05 mg/ml y posteriormente se
incubaron. Al final del periodo de incubación se determinó la cinética de producción
estimulada por succinato (5 mM por pocillo) durante 90 minutos tras la adicción de
luminol a una concentración por pocillo de 25 µM y HRP a una concentración de 10
µg/ml. La concentración de proteína por pocillo fue de 0,01 mg/pocillo. Todas las
determinaciones se realizaron por triplicado.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
189
Ilustración 42 Esquema del procedimiento para la determinación de la producción
hidroperóxidos
3.1.7 MEDIDA DE LA ACTIVIDAD DE MANGANESO SUPERÓXIDO DISMUTASA
3.1.7.1 Fundamento básico
El análisis de la actividad de la Sod2 se basó en la medida de la cinética de la reacción
por colorimetría a través del siguiente conjunto de reacciones:
Ilustración 43 Esquema de las reacciones para la medida de la actividad superóxido
dismutasa
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
190
Como se observa en la figura 43 en este ensayo se genera O2*‐ a través de la reacción de
la xantina con el oxígeno generando agua y ácido úrico por acción de la xantino oxidasa
(XOD) (1). Dicho O2*‐ reacciona con el WST‐1 que se transforma en WST‐1 formazan que
absorbe luz a una longitud de onda de 450 nm (2). La Sod2 reduce la concentración de
O2*‐, transformándolo en H2O2, y por tanto inhibe la formación de WST‐1 formazan
(Ukeda et al 1997) (3). Así, la reducción en la aparición de WST‐1 formazan es una
medida indirecta de la actividad Sod2 presente en los extractos mitocondriales. Dichas
reacciones se midieron empleando un Kit comercial de la casa Assay Dessigns (Cat. Nº
900‐157).
3.1.7.2 Reactivos
Superóxido dismutasa actividad de 50 U/µl
Buffer Sod 10X
Succinato 5mM
Xantino oxidasa
Reactivo WST‐1
Agua ultrapura
Medio respiratorio
3.1.7.3 Material y equipos
Multiskan spectrum (Thermo Scientific)
Placas de espectrofotometría de 96 pocillos
Agitador orbital de placas
3.1.7.4 Procedimiento
Primeramente se descongelaron las muestras a 4oC, se diluyeron a una concentración de
1 mg/ml y se trataron con los diferentes antioxidantes, según el procedimiento descrito
anteriormente. Al final del tratamiento se realizaron tres diluciones de cada muestra en
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
191
buffer Sod 1X hasta alcanzar concentraciones de 1, 25 y 75 µg proteína por pocillo.
Paralelamente se realizó una curva de Sod con el estándar suministrado por el fabricante
según las instrucciones del Kit. Para mantener las condiciones experimentales similares a
las de la medida de ROS se añadió succinato (5 mM) al medio de reacción. Se siguieron
el resto de las instrucciones del fabricante para la preparación de los diferentes
reactivos y se midió la cinética de inhibición de la formación de WST‐1 formazan a 450
nm durante 15 minutos.
3.1.8 MEDIDA DE LA ACTIVIDAD GLUTATIÓN PEROXIDASA
3.1.8.1 Fundamento básico
Al igual que en el caso de la actividad Sod el análisis de la actividad de la mtGpx se basó
en el seguimiento de la cinética de reacción por colorimetría del siguiente conjunto de
reacciones:
Ilustración 44 Esquema de las reacciones para la medida de la actividad glutatión
peroxidasa
La Gpx cataliza la reacción de oxidación del GSH (1) dando lugar a GSSG. El GSSG es de
nuevo reducido a GSH por acción de la glutatión reductasa (2). En esta reacción se
produce una disminución de NADPH, que absorbe luz a 340 nm. Así, el descenso en la
absorbancia a 340 nm es directamente proporcional a la actividad Gpx presente en la
muestra (Ozdemir et al 2005). La actividad de la Gpx fue medida a través de un Kit de la
casa Assay Dessigns (Cat. Nº 900‐158).
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
192
3.1.8.2 Reactivos
GSH+NADPH en viales liofilizados
Glutatión reductasa
Glutatión peroxidasa
Cumene hidroperóxido
Buffer 10X
Succinato 5 mM
Agua ultrapura
3.1.8.3 Material y equipos
Multiskan spectrum (Thermo Scientific)
Placas de espectrofotometría de 96 pocillos
Agitador orbital de placas
3.1.8.4 Procedimiento
A continuación del tratamiento con antioxidantes los extractos mitocondriales se
diluyeron en buffer 1X hasta alcanzar una concentración de 75 µg proteína por pocillo.
Para mantener las condiciones experimentales similares a las de los experimentos
previos se añadió succinato (5 mM) al medio de reacción. Se siguieron el resto de las
instrucciones del fabricante para la preparación de los diferentes reactivos. Se introdujo
en cada medida un control positivo de actividad Gpx distribuido por el fabricante, y un
control negativo con buffer 1X. Se procedió al seguimiento de la disminución de NADPH,
mediante la reducción de la absorbancia a 340 nm durante 10 minutos.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
193
3.1.9 MEDIDA DEL CONSUMO DE OXÍGENO Y DE ESTADOS RESPIRATORIOS
3.1.9.1 Fundamento básico
El método utilizado se basa en la capacidad de un electrodo de oxígeno tipo Clark para
detectar pequeñas y rápidas variaciones en la utilización del oxígeno de mitocondrias
aisladas. Chance y Williams (1956) fueron los primeros en adaptar los métodos
polarográficos al estudio de la respiración mitocondrial y la fosforilación de ADP (Chance
and Williams 1956).
La célula de medición de oxígeno tipo Clark consiste en un cátodo de platino que actúa
como electrodo de trabajo, y un ánodo de plata que tiene una doble función: actuar
como contraelectrodo y como electrodo de referencia. Los electrodos están en contacto
a través de una solución electrolítica de KCl. Una membrana separa los electrodos y el
electrolito permitiendo la difusión de oxígeno e impidiendo a su vez la contaminación
del electrodo. Una vez estabilizado el sistema se aplica una tensión de polarización entre
el ánodo y el cátodo, comprendida entre 700 y 800 mV. Si la célula entra en contacto
con un medio que contiene oxígeno disuelto, este difunde a través de la membrana y las
moléculas de O2 son reducidas en el cátodo. Una cantidad electroquímica equivalente de
cloruro de plata es depositada sobre el ánodo. El cátodo cede cuatro electrones por
cada molécula de oxígeno, el ánodo de plata los acepta y se genera una corriente que es
directamente proporcional a la presión parcial del oxígeno disuelto en el agua que
estamos midiendo.
3.1.9.2 Reactivos
Medio Respiratorio
Rotenona 5 µM
Succinato 5 mM
ADP 0,1 mM
CCCP 1 µM
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
194
Agua ultrapura saturada de oxígeno
3.1.9.3 Material y equipos
Electro de oxígeno tipo Clark
Caja de Control (Respire 1, Hansatech)
Registrador (3021 Pen Recorder, Yokogawa)
Microjeringas (MicroliterTM Syringe, Hamilton)
Baño termostatizado a 30ºC (Tectron 3000543, Selecta)
Bomba de vacío
3.1.9.4 Procedimiento
Previamente a la medida se diluyeron las suspensiones de mitocondrias frescas en
medio respiratorio hasta una concentración de aproximada de 10 mg/ml y se incubaron
con los antioxidantes según lo descrito anteriormente.
La unidad del electrodo de oxígeno está conectada a un dispositivo de control y éste a su
vez con un registrador gráfico. Para la calibración del electrodo se pipetean 2ml de Agua
ultrapura en la cámara del electrodo a la que se le añaden unos pocos cristales de
ditionito sódico (Na2S2O4), que provoca que la concentración de O2 descienda
rápidamente a cero. En ese momento se ajusta el valor del registrador y del dispositivo
de control a cero, correspondiente a la ausencia de corriente eléctrica. Seguidamente,
se aspira esta solución con una bomba de vacío y, tras minuciosos lavados de la cámara
con Agua ultrapura, se pipetean 2 ml de agua ultrapura saturada de oxígeno a 30oC. El
valor estable que se registra en milivoltios equivale a 256 nm O2/ml. Finalmente se
pipeteó en la cámara 1 ml de medio respiratorio. Este tipo de electrodos está provisto
de un tapón de metraquilato que impide el intercambio de gases entre la superficie de la
solución y el aire. Por otra parte, este tapón contiene una pequeña apertura por la que
se pueden añadir al medio tanto la suspensión de mitocondrias como los diferentes
substratos con la ayuda de microjeringas. Todas las medidas se realizaron a 30oC y en
constante agitación para facilitar el establecimiento de un equilibrio entre el oxígeno
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
195
disuelto en la solución y la difusión de gas a través de la membrana de
olitetrafluorometileno del electrodo de oxígeno.
Ilustración 45 Consumo de oxígeno en los diferentes estados respiratorios (gráfica
obtenida en un oxígrafo). Adaptada de Curti et al (1999)
Una vez estabilizado el valor registrado en el medio respiratorio, se añade a través de la
apertura un volumen de suspensión de mitocondrias, tanto las tratadas con
antioxidantes como los controles, suficiente para obtener 1 mg de proteína mitocondrial
en el medio y se mantiene durante aproximadamente 1 minuto para estabilizar el
registró y permitir que se oxiden los posibles substratos endógenos. Seguidamente, se
añade rotenona (5 µM), inhibidor del complejo I, y el succinato y se mantiene el registró
del estado 2 durante unos minutos, tras lo que se añade la cantidad necesaria de ADP
(0,1 mM) para poder registrar el estado 3 y el estado 4 en las mitocondrias analizadas.
Posteriormente se repite la adición de ADP al doble de concentración estableciendo de
nuevo el estado 3 y el estado 4. Finalmente, se procede añadir CCCP (1 µM) para
desacoplar la cadena de transporte de electrones. Como medida de la eficiencia de la
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
196
fosoforilación oxidativa empleamos el ratio P/O como fue descrito por Hinkle et al
(2005) (Hinkle 2005).
3.1.10 ANÁLISIS ESTADÍSTICO DE LOS DATOS
La normalidad de todos los datos se comprobó mediante los test de Shapiro‐Wilk y
Kolmogorof‐Smirnov, y en función de la misma se evaluaron los datos de forma
paramétrica o no paramétrica. Todos los valores son presentados como media ± error
estándar de la media. Para cada variable se realizó un Anova de dos vías de medidas
repetidas con el fin de evaluar el efecto del tiempo y el tratamiento en la variable
analizada así como la posible interacción entre ambos factores. En los casos en los que
se observó interacción, se realizó efectuó un Anova de una vía de medidas repetidas
para cada variable y cada tiempo de incubación con un test post‐hoc de Dunnett. Las
pruebas de correlaciones fueron realizadas con el coeficiente de Pearson. El nivel de
significación estadístia fue establecido para una probabilidad P<0,05. Para la realización
de todos los análisis estadísticos se utilizó el programa GraphPad Prism 5.0 (Graph Pad
Software, San Diego, CA).
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
197
3.2 ESTUDIOS IN VIVO
3.2.1 ANIMALES DE EXPERIMENTACIÓN
Los animales empleados para este estudio fueron ratas (Rattus Norvergicus) Wistar
macho con un peso medio inicial de 211,76 gramos (6 semanas de edad) suministradas
por el Centro de Investigacion en Farmacobiología Aplicada (CIFA, Universidad de
Navarra, Pamplona, España). Los animales se mantuvieron en jaulas de propileno de 19
x 43 x 26 cm provistas de una rejilla de acero inoxidable (tres‐cuatro animales por jaula)
bajo condiciones controladas de luz con ciclos de 12 h de luz/oscuridad, una
temperatura de 22 ± 2oC y humedad relativa de 55 ± 10%. Todos los procedimientos
experimentales fueron realizados de acuerdo con las Guías Nacionales e Institucionales
de Cuidado y Uso de Animales y con la aprobación del Comité de Ética para la
Experimentación Animal (CEEA) de la Universidad de Navarra. Antes de comenzar el
estudio los animales fueron sometidos a un período de adaptación a estas condiciones
de cinco días.
3.2.2 DIETAS
Para este estudio se emplearon dos dietas diferentes tanto en su composición como en
la cantidad de energía aportada por cada una de ellas. Así, se empleó una dieta alta en
grasa para inducir sobrepeso y obesidad en los animales, en comparación con la dieta
control o dieta estándar de laboratorio. La ingesta de ambas dietas fue ad libitum y los
animales tuvieron libre acceso al agua de bebida.
La dieta estándar o control fue suministrada por Harlam Teklad Global Diets y la dieta
alta en grasa por OpenSource diets Research Diets. En la siguiente Tabla se detalla la
composición en macronutrientes de ambas dietas:
Tabla 4 Composición nutricional de las dietas experimentales
Dieta control Dieta alta en grasa
Energía (Kcal/100 g) 310 524
Proteínas (%VCT) 16,7 % 20 %
Lípidos (%VCT) 4,6 % 60 %
Carbohidratos (%VCT) 78,6 % 20 %
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
198
3.2.3 DISEÑO EXPERIMENTAL
La presente tesís forma parte de un estudio anterior desarrollado en el departamento
de Ciencias de la Alimentación, Fisiología y Toxicología de la Universidad de Navarra en
el que se analizaron los efectos del tratamiento con ácido lipoico sobre la obesidad y sus
complicaciones asociadas en un modelo de obesidad inducida por la dieta. En particular
en esta tesis analizamos las acciones de este antioxidante en el desarrollo de la
enfermedad hepática no alcohólica seleccionándose los distintos grupos experimentales
en función de los aspectos a estudiar en cada capítulo. En el siguiente esquema se
recoge el diseño experimental general del estudio.
Ilustración 46 Diseño experimental del estudio in vivo
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
199
El AL (sintético; ≥ 99% pureza; Sigma Aldrich, Alemania) se administró mezclado con las
diferentes dietas en una proporción de 0,25 g/100 g de comida basándonos en estudios
previos (Kim et al 2004). Los 46 animales del estudio se distribuyeron en cinco grupos
experimentales recibiendo los diferentes tratamientos dietéticos durante 8 semanas. La
descripción del tratamiento dietético y la denominación de los grupos experimentales se
recogen en la siguiente tabla:
Tabla 5 Descripción de los grupos experimentales
Grupo Dieta Suplementación Tamaño muestral
Control Estándar No 10
CLIP Estándar Si (AL 0,25 g/100 g) 10
OB Alta en grasa No 10
OLIP Alta en grasa Si (AL 0,25 g/100 g) 10
PFO Alta en grasa No 6
Durante el tratamiento se registró el peso corporal y la ingesta energética cada 2 o 3
días. Antes del sacrificio se sometió a los animales a un periodo de ayuno de 12 horas
después del cual se sacrificaron por decapitación. Inmediatamente después del sacrificio
se extrajeron los hígados y se pesaron. Una parte del órgano se congeló en nitrógeno
líquido y se conservó a ‐80 ºC para posteriores determinaciones. Otra parte se empleó
directamente para la obtención de los extractos mitocondriales que una vez obtenidos
se conservaron a ‐80oC para la determinación de las defensas antioxidantes según el
protocolo descrito en el punto 3.1.3. Por otro lado, se tomaron biopsias de tejido para el
posterior análisis histológico. Además, se recogió la sangre de cada animal para la
obtención de suero y plasma la medida de diferentes determinación bioquímicas y de
los concentrados eritrocitarios para las diferentes medidas.
Los grupos Control, CLIP, Obeso y OLIP se tomaron como módelos de diferentes estados
antioxidantes para el estudio del segundo objetivo de esta tesis. Así en estos grupos, se
analizaron los efectos del ácido lipoico sobre las defensas antioxidantes eritrocitarias y
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
200
mitocondriales, el daño oxidativo hepático y el potencial papel de los eritrocitos como
biomarcadores del estado antioxidante en el compartimento hepático mitocondrial. Las
determinaciones llevadas a cabo se resumen en la siguiente figura:
Ilustración 47 Diseño experimental del estudio in vivo I
Por otro lado, para evaluar los potenciales efectos preventivos del tratamiento con ácido
lipoico sobre el desarrollo y evolución de la enfermedad hepática no‐alcohólica inducida
por una dieta alta en grasa, se eligieron los grupos control, obeso, OLIP y pair‐fed OLIP.
Los aspectos a estudiar en estos animales se dividieron en dos grandes grupos; primero,
los relacionados con los procesos bioenergéticos mitocondriales y el metabolismo
lipídico; segundo, los asociados a la regulación del balance pro‐oxidante/antioxidante. El
diseño experimental de este grupo de experimentos se recoge en la ilustración 48:
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
201
Ilustración 48 Diseño experimental in vivo II
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
202
3.2.4 DETERMINACIONES BIOQUÍMICAS EN SANGRE
Las determinaciones bioquímicas se realizaron en el suero que se obtuvo tras la recogida
de la sangre total en tubos Vacutainer heparinizados (Becton Dickinson, Gran Bretaña) y
tras su centrifugación a 2200 g durante 15 minutos a 4oC.
3.2.4.1 Determinación de los niveles de glucosa
Los niveles séricos de glucosa se cuantificaron en un autoanalizador COBAS‐Mira
empleando un método enzimático colorimétrico (Glucose HK CP, ABX Pentra) basado en
la siguiente reacción:
HNADHGluconatoDNADFosfatoaGlu
ADPfosfatoaGluATPaGluDPDHaGlu
aHexoquinas
6cos6cos
6coscos
Ilustración 49 Reacción enzimática para la determinación de los niveles séricos de glucosa
3.2.4.2 Medida de los niveles séricos de transaminasas hepáticas: ALT y AST
Uno de los parámetros bioquímicos empleados para la valoración de la función hepática
son los niveles séricos de transaminasas, principalmente la alanina aminotransferasa
(ALT) y la aspartato aminotransferasa (AST), así como la relación entre ambas para
determinar el origen hepático de las alteraciones enzimáticas observadas así como para
discernir si se trata de un proceso agudo o crónico.
Los niveles séricos de ambas enzimas se determinan a través de un método enzimático
colorimétrico en un autoanalizador COBAS‐Mira. La medida de la actividad AST se basa
en la medida de la oxidación de NADH asociado al siguiente conjunto de reacciones,
mediante el cambio en la absorbancia a 340 nm:
NADMalatoLHNADHoOxalacetat
glutamatoLoOxalacetattooxoglutaraAspartatoLMDH
AST2
Ilustración 50 Reacciones enzimáticas implicadas en la determinación de los niveles
séricos de AST
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
203
Al igual que en el caso de la determinación de la actividad de la AST, los niveles séricos
de ALT se fundamentan en la medida de la oxidación de NADH, pero basándose en el
papel catalizador de la ALT en otro conjunto de reacciones a partir de la L‐Alanina para
producir piruvato que, a su vez, reacciona con el NADH produciendo lactato como se
recoge en la siguiente figura:
NADLactatoLHNADHPiruvato
glutamatoLPiruvatotooxoglutaraAlaninaLLDH
ALT2
Ilustración 51 Reacciones enzimáticas implicadas en la determinación de los niveles
séricos de ALT.
3.2.5 DETERMINACIÓN DE LOS NIVELES DE INSULINA POR ELISA
3.2.5.1 Fundamento básico
La técnica de ELISA se basa en el siguiente conjunto de reacciones (Ilustración 54):
1. Inmunocaptura: en este paso se produce la unión de la molécula diana a un
anticuerpo policlonal primario inmovilizado en un soporte rígido.
2. En la segunda reacción un anticuerpo secundario biotinilado se une al
anticuerpo primario formando un complejo con el mismo.
3. Detección: en esta última fase se añade un conjugado de HRP y estreptavidina
(Strp) que reconoce el anticuerpo biotinilado. A continuación se añade un
substrato de la HRP que se puede detectar por colorimetría directa.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
204
Ilustración 52 Fundamento teórico de la detección de los niveles de insulina por el
método de ELISA
3.2.5.2 Material y equipos
Kit de ELISA para la determinación de insulina de rata (Linco Research Inc). Cat nº.
EZRMI‐13K.
Vórtex
Multiskan spectrum (Thermo Scientific)
Agitador orbital de placas
3.2.5.3 Procedimiento
Antes de empezar el análisis de las muestras se prepararon todos los reactivos y se
llevaron a temperatura ambiente durante al menos media hora, además se procedió a
realizar tres lavados previos de los pocillos que se iban a emplear con buffer de lavado.
A continuación se añadieron las muestras, los estándares y controles a los pocillos según
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
205
la plantilla establecida y posteriormente el anticuerpo biotinilado. Se incubó la placa
durante 2 horas a temperatura ambiente en agitador orbital de placas Posteriormente
se lavó tres veces y se añadió la enzima HRP, se selló la placa y se incubó de nuevo
durante 30 minutos con agitación suave. Tras la incubación se lavó seis veces y se añadió
el substrato de la enzima y tras 20 minutos de incubación se leyó la placa en un
espectrofotómetro a una longitud de onda de 370 nm. Para calcular la concentración de
de insulina se tomó como referencia la curva interna de cada experimento y se empleó
el control negativo como blanco. Tras la interpolación de los datos a la curva se aplicó el
factor de dilución correspondiente. Todas las muestras, estándares y controles se
midieron por duplicado.
3.2.6 MEDIDA DEL ÍNDICE HOMA
El índice de resistencia a la insulina homeostasis model assesment (HOMA), permite
realizar estimaciones de resistencia insuliníca y función de las células beta mediante las
concentraciones de la glucosa y la insulina plasmáticas en ayunas. El índice se calculó
según la fórmula propuesta por Matthews y colaboradores (1985) que se recoge a
continuación:
5,22
)/()(cos.
mlUIInsulinammolesaGluHOMAIndice
3.2.7 OBTENCIÓN DE ERITROCITOS
En el momento del sacrificio se recogió la sangre en tubos Vacutainer Gel SST II
(Vacutainer, Becton Dickinson, Gran Bretaña). Seguidamente fue centrifugada a 2200 g a
4oC durante 15 minutos. El pellet, que contenía los eritrocitos, fue resuspendido en
PBS1X y congelado a ‐80oC para las posteriores determinaciones
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
206
3.2.8 ANÁLISIS HISTOLÓGICO
3.2.8.1 Fundamento básico
Para el análisis de tejidos por microscopia óptica es necesario previamente llevar a cabo
diferentes procesos, que se pueden resumir en cuatro grupos:
Fijación química del tejido
Infiltración en parafina
Cortado
Tinción: en nuestro estudio se utilizaron dos tipos de tinción. Con el colorante
Hematoxilina‐eosina para el análisis de las estructuras generales y la presencia de
gotas lipídicas y la tinción con Rojo Sirio con el fin de estudiar el contenido y
distribución del colágeno en el tejido hepático. En las siguientes Ilustraciónes se
muestran varias de las micrografías obtenidas en las que se han señalado las
diferentes estructuras observadas.
Análisis microscópico y fotografía
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
207
Ilustración 53 Micrografías de hígado de rata teñidas con hematoxilina‐eosina (HE) y rojo
sirio (RS). Panel 1 se observa la vena central del lobulillo (VC), los sinusoides hepáticos (S) y
el espacio interlobulillar (IL). Panel 2 se pueden diferenciar los diferentes tipos celulares
hepáticos: hepatocitos (H), células estelares (CE) y células de Kupfer (CK). Panel 3 se
diferencia la presencia de macro (MV) y micro (µV) vesículas lipídicas. Panel 4 se ofrece una
visión general de la estructura hepática donde se han resaltado las diferentes VC de los
lobulillos rodeadas de colágeno. Panel 5 se observan las fibras de colágeno (FC) infiltradas
dentro del parénquima hepático. Panel 6 se puede observar el aumento de colágeno en
torno a la pared de la VC así como los sinusoides.
3.2.8.2 Procedimiento
En el momento del sacrificio se recogió una biopsia hepática que se fijó en para‐
formaldehido (4%) durante 48 horas. Posteriormente se continuó la fijación en etanol al
70% durante dos semanas. La inclusión en parafina líquida, los cortes en micrótomo (20
µm) y las tinciones se realizaron en el Servicio de Imagen del Centro de Investigación
Médica Aplicada (CIMA) bajo la supervisión de la Dra. Guembe. Los cambios histológicos
fueron analizados y fotografiados empleando el microscopio óptico de luz polarizada
Nikon eclipse E800 (Nikon Corporation, Japan) y el software de obtención de imágenes
ACT‐1 (Nikon Corporation, Japan).
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
208
3.2.9 DETERMINACIÓN DEL CONTENIDO EN TRIGLICÉRIDOS HEPÁTICOS
3.2.9.1 Reactivos
Buffer de homogeneización (pH 8)
NaCl 150 mM
Tritón 0,1%
Tris‐HCl 10 mM (pH 8)
Kit enzimático Pentrax (Horiba ABX, USA)
3.2.9.2 Material y equipos
Baño húmedo termostatizado con agitación
Sonicador Branson 250
Autoanalizador rápido COBAS‐Mira (Roche Diagnostics, Switzerland)
Microcentrífuga de mesa Eppendorf 5415 R
3.2.9.3 Procedimiento
Para la determinación de triglicéridos hepáticos se utilizaron aproximadamente 150 mg
de hígado congelado que fueron introducidos en buffer de homogeneización
previamente calentado a 50ºC en una proporción 1:10. A continuación se sonicaron las
muestras durante 40 segundos en un sonicador Branson 250 a 4oC, con pulsos de 1
segundo y una amplitud del 40%. Inmediatamente se centrifugaron a 12000 g durante
10 minutos a 4oC, se recogió el sobrenadante en el que se determinó el contenido en
triglicéridos en un autoanalizador COBAS‐Mira empleando el kit comercial Pentrax
(Horiba ABX) como se ha descrito previamente (Perez‐Echarri et al 2009). Los resultados
se corrigieron por el peso de tejido empleado y se presentaron en porcentaje de
triglicéridos por 100 g de tejido.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
209
3.2.10 MEDIDA DE LOS NIVELES DE MALONILALDEHÍDO EN HÍGADO
3.2.10.1 Fundamento básico
El método empleado para la medida de la concentración de MDA se basa en el
seguimiento por colorimetría de la reacción del MDA con el ácido tiobarbitúrico (TBA)
formando aductos de MDA+TBA como se recoge en la siguiente ilustración:
Ilustración 54 Reacción de formación de aductos de MDA‐TBA
Dicha reacción se produce a altas temperaturas y se puede monitorizar por colorimetría
mediante la medida de la absorbancia a 540 nm.
3.2.10.2 Reactivos
Ácido tiobarbitúrico
Ácido acético
NaOH
Estándar de MDA
Solución de SDS
Buffer RIPA (pH 7,2)
NaH2PO4 1M
Na2HPO4 200 mM
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
210
SDS 10%
NaCl 5M
NP40 1%
Inhibidores de proteasas
104 mM 4‐ (2‐aminoetil)benzenesulfonil fluorhídrico (AEBSF)
80 µM aprotinina
4 mM Bestatina
1,4 mM E‐64
2 mM leupeptina
1,5 mM pepstatina
1 mM PMSF
Agente colorante
Ác. Tiobarbiturico
Ác. Acético
NaOH
3.2.10.3 Material y equipos
Balanza de precisión
Baño húmedo termostatizado con agitación
Multiskan spectrum (Thermo Scientific)
Sonicador Branson 250
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
211
Microcentrífuga de mesa Eppendorf 5415 R
3.2.10.4 Procedimiento
Se emplearon aproximadamente 25 mg de tejido a los que se añadió 250 µl buffer RIPA
con inhibidores de proteasas. Se sonicaron las muestras durante 15 segundos en hielo.
Posteriormente se centrifugó el homogeneizado a 1600 g durante 10 minutos a 4oC y se
recogió el sobrenadante. Para la inducción de la formación de aductos de MDA‐TBA2 se
mezclaron 100 µl de muestra, 100 µl de solución de SDS y 4 ml de solución colorante y
se hirvieron en baño húmedo durante 1 hora. A continuación se paró la reacción
introduciendo los viales en hielo durante 10 minutos. Posteriormente se centrifugaron
las muestras a 1600 g durante 10 minutos a 4oC y 150 µl del sobrenadante se añadieron
a la placa de espectrofotometría para su lectura a 530 nm, dentro de cada placa se
introdujo una curva de calibración de MDA.
3.2.11 MEDIDA DE LA ACTIVIDAD SUPERÓXIDO DISMUTASA EN MITOCONDRIAS AISLADAS
Y ERITROCITOS
3.2.11.1 Fundamento básico
La determinación de la actividad Sod en mitocondrias aisladas de hígado se llevó a cabo
siguiendo el protocolo descrito en el punto 3.1.7. Sin embargo, en el caso de los
concentrados de eritrocitos aunque se empleó el mismo protocolo, la preparación de la
muestra varió. Asi, antes de determinar la actividad enzimática es necesario lisar los
eritrocitos y purificar la muestra del contenido en hemoglobina que puede interfierir en
la medida colorimétrica. Así, en este punto describiremos exclusivamente la preparación
de la muestra.
3.2.11.2 Reactivos
Etanol (<99% de pureza)
Cloroformo
Fosfato potásico 50 mM (pH 7,8)
Agua ultrapura
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
212
3.2.11.3 Material y equipos
Tripa de diálisis
Agitadores magnéticos
Vórtex
Centrifuga RC 28 S (Sorwall)
Rotor SS‐34 (Sorwall)
Adaptadores para rotor SS‐34 (Sorwall)
Microcentrífuga de mesa Eppendorf 5415 R
3.2.11.4 Procedimiento
Para lisar los eritrocitos se les añadieron 10 volúmenes de Agua ultrapura a 4oC, se
mezclaron con Vórtex y se incubaron en hielo durante 15 minutos. Se utilizó como
control de lisis el cambio de color de la solución a rojo claro brillante. Para precipitar la
hemoglobina se trataron las muestras con 0,25 volúmenes de etanol y 0,15 volúmenes
de cloroformo y se agitaron suavemente durante 1 minuto. Inmediatamente se
centrifugaron a 10000 g durante 10 minutos a 4oC. Tras la centrifugación se recogió la
capa superior formada por una solución transparente y se dializó en membranas de
diálisis frente a fosfato potásico 50 mM durante toda la noche en refrigeración.
Posteriormente, el dializado se centrifugó a 10000 g durante 10 minutos a 4oC y en el
sobrenadante se determinó la actividad Sod conforme al protocolo descrito
previamente.
3.2.12 MEDIDA DE LA ACTIVIDAD GLUTATIÓN PEROXIDASA EN MITOCONDRIAS AISLADAS
Y ERITROCITOS
3.2.12.1 Fundamento básico
De igual manera que en el caso de la actividad Sod para la determinación de la actividad
Gpx en mitocondrias aisladas se siguió el protocolo descrito en el punto 3.1.8. Para la
determinación en eritrocitos fue necesaria una preparación de muestra que está
fundamentada en el lisado de los eritrocitos.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
213
3.2.12.2 Reactivos
PBS
Agua ultrapura
3.2.12.3 Material y equipos
Vórtex
Centrifuga RC 28 S (Sorwall)
Rotor SS‐34 (Sorwall)
Adaptadores para rotor SS‐34 (Sorwall)
Microcentrífuga de mesa Eppendorf 5415 R
3.2.12.4 Procedimiento
Para el lisado de eritrocitos primero se lavaron las muestras dos veces con PBS 1X a 4oC
y entre lavados se centrifugaron a 1500 g durante 10 minutos a 4oC. A continuación de
descarto cuidadosamente el sobrenadante y se añadieron 5 volúmenes de Agua
ultrapura a 4oC y se incubaron en hielo durante 10 minutos vorteándo las muestras
frecuentemente. Inmediatamente se centrifugaron a 10000 g durante 15 minutos a 4oC.
Se recogió el sobrenadante en el que se determinó la concentración de proteína
mediante Bradford y se congeló a ‐80oC para la posterior determinación de la actividad.
3.2.13 MEDIDA DEL RATIO GSH:GSSG EN MITOCONDRIAS AISLADAS Y ERITROCITOS
3.2.13.1 Fundamento básico
La determinación del contenido en glutatión total, reducido y oxidado se basó en el
seguimiento por colorimetría de la cinética del conjunto de reacciones recogidas en la
ilustración 50.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
214
Ilustración 55 Esquema de las reacciones para la medida del contenido en glutatión
La GR reduce el GSSG a GSH a expensas de la oxidación de NADPH2 (1). Posteriormente
el grupo sulfihidrilo del GSH reacciona con el DTNB (ácido 5,5’‐dithiobis‐2‐nitrobenzoico)
para producir TNB (ácido 5‐thio‐2‐nitrobenzoico) que absorbe luz a 405 nm. (2)
(Mytilineou, Kramer and Yabut 2002, Onyango and Khan 2006). Así el ratio de
producción de TNB es directamente proporcional a la concentración de glutatión en la
muestra. Para la determinación de la concentración de GSH en la muestra se trató la
misma con 4‐vynilpyridin y por diferencia se obtuvo el ratio entre GSH y GSSG. El
contenido en glutatión fue medido a través de un Kit de la casa Assay Dessigns (Cat. No
900‐160).
Previamente a las determinaciones explicadas se procedió a la extracción del glutatión
de la matriz proteica mediante el tratamiento con ácido metafosfórico.
3.2.13.2 Reactivos
25X Assay Buffer
GSSG (4 μM)
Glutatión reductasa
Ácido metafosfórico 5% (p/v)
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
215
4‐vynilpyridin
PBS
Agua ultrapura
3.2.13.3 Material y equipos
Vórtex
Microcentrífuga de mesa Eppendorf 5415 R
Campana de extracción
Multiskan spectrum (Thermo Scientific)
Placas de espectrofotometría de 96 pocillos
Agitador orbital de placas
3.2.13.4 Procedimiento
Tras la descongelación de las muestras, los concentrados eritrocitarios y los extractos
mitocondriales se trataron con cuatro volúmenes de ác. Metafosfórico al 5% (p/v) y se
incubaron en hielo durante 15 minutos vorteando periódicamente. Posteriormente, se
centrifugaron a 14000 g durante 15 minutos a 4oC y se recogió el sobrenadante para la
determinación. Se realizaron tres diluciones de cada una de la muestras para los cálculos
posteriores. En cada placa de lectura se introdujo una curva de calibración de GSSG con
el estándar suministrado por el fabricante. Paralelamente, se trató la primera dilución
de las muestras y la curva de calibración con 4‐vynilpiridin 2M durante 1 hora a
temperatura ambiente para la posterior determinación del contenido en GSH. Se
siguieron el resto de las instrucciones del fabricante para la preparación de los
diferentes reactivos y se midió la formación de TNB a 405 nm durante 10 minutos. Todas
las muestras se midieron por triplicado.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
216
3.2.14 ANÁLISIS DE LA EXPRESIÓN GÉNICA POR RT‐qPCR
3.2.14.1 Extracción de RNA
La extracción de RNA total del hígado se llevó a cabo mediante el método del TRIZOL©
(Invitrogen), que consiste en una solución monofásica de fenol e isotiocianato de
guanidina. Se trata de una modificación de Chomczynski y Sacchi (1987). Durante esta
homogenización, el Trizol mantiene la integridad del RNA, mientras que rompe las
células y disuelve los componentes celulares. Con este método, se puede partir de
pequeñas cantidades de tejido, obteniéndose un RNA total libre de contaminación por
proteínas y DNA.
Para la realización de la extracción del RNA total se adicionaron a 0,1 g de hígado 1 ml
de Trizol® en tubos de polipropileno previamente autoclavados, y con ayuda de un
ultraturrax se homogeneizó el tejido. Posteriormente, se agitaron vigorosamente
durante 1 minuto (para permitir la completa disociación de los complejos
nucleoproteína), y tras un periodo de incubación de 5 minutos a temperatura ambiente
se centrifugaron a 12.000 x g durante 10 minutos a 4 ºC, para eliminar los principales
restos celulares.
A continuación, se añadieron 200 μL de cloroformo por mL de Trizol® añadido y se agitó
vigorosamente para conseguir una completa distribución del cloroformo (Sigma‐Aldrich)
sobre la fase del Trizol®. Tras esperar 2‐3 min, se volvió a centrifugar a 12000 g durante
20 minutos a 4oC y se logró separar la solución en tres fases: una fase superior acuosa
transparente (donde se encuentra el RNA), una interfase donde se encuentran las
proteínas y una fase inferior orgánica donde se encuentra el DNA. Se recogió la fase
superior acuosa a la que se añadió isopropanol (Sigma‐Aldrich) (500 μL por mL de Trizol
utilizado) y Glycoblue (Ambion) (3 μL por muestra) y se agitó ligeramente. El Glycoblue
permite identificar mejor el pellet de RNA al teñirlo ligeramente de azul. Tras 10 minutos
de incubación a temperatura ambiente, se centrifugó a 12000 x g durante 20 minutos y
a 4oC.
Una vez obtenido el pellet, se realizaron dos lavados con 75% Etanol‐DEPC
(dietilpirocarbonato sódico, Sigma‐Aldrich) (0,01%) y se volvió a centrifugar de nuevo a
12000g durante 5 minutos. Se retiró todo el etanol y se dejó secar el pellet a
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
217
temperatura ambiente durante 2 minutos. El DEPC inhibe las posibles RNAsas presentes
en la solución de 75% etanol y que podrían degradar la calidad del RNA obtenido. El RNA
fue resuspendido en la solución RNA secure (Ambión, Austin, USA) utilizando un
volumen de 20 μl por muestra, y se incubó durante 10 minutos en baño seco a 55‐65oC
para disolver el pellet e inactivar las RNAsas. Se enfrió en hielo y se procedió a la
cuantificación del RNA total presente en cada muestra así como su grado de pureza
respecto a proteínas y sales minerales utilizando el espectrofotómetro Nanodrop
ND1000 (Thermo Scientific, Wilminton, DE, USA). Para determinar la pureza de la
muestra nos fijamos en el ratio de las absorbancias a 260, 280 y 230 nm. A continuación
se congeló a ‐80oC hasta su posterior utilización.
3.2.14.2 Tratamiento con DNAasa y retrotranscripción
De forma previa a la retrotranscripción se realizó un tratamiento con DNAasas (Ambion,
Austin, USA) con la finalidad de obtener un RNA más puro y libre de contaminaciones
con DNA genómico. Para ello, se tomaron 2 μg de RNA, que se incubaron durante 30
minutos a 37 ºC en presencia de la enzima DNAsa, la cual degrada los restos de DNA
genómico presentes en la muestra.
Seguidamente se realizó la retrotranscripcion de cada una de las muestras, que consiste
en la obtención de DNA complementario (cDNA) a partir del RNA total obtenido, para el
posterior analisis de la expresión génica mediante PCR cuantitativa a tiempo real (RT‐
qPCR). Para cada muestra se realizó la retrotranscripcion de 4 µg de RNA utilizando la
enzima retrotranscriptasa inversa (M‐MLV, Invitrogen) en presencia de la enzima
inhibidora de ribonucleasas (RNasin., Promega) en la siguiente proporción: 4 µl Buffer
5x, 2 µl DTT, 1 µl RNasin y 1 µl M‐MLV.
Se incubaron las muestras durante 10 minutos a 25oC, 60 minutos a 37oC y finalmente
15 minutos a 70oC (inactivación de la enzima). Las muestras de DNA complementario
obtenido (cDNA) se alicuotaron y se guardaron a – 80oC hasta su utilización.
3.2.14.3 Análisis de expresión génica
La determinación de los niveles de expresión génica se llevó a cabo mediante PCR
cuantitativa a tiempo real, que se basa en la actividad 5´exonucleasa de la Taq
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
218
polimerasa en el que se utiliza una sonda específica del gen marcada con fluorescencia y
dos cebadores oligonucleotídicos. Mediante esta técnica, se puede determinar en
tiempo real la amplificación del gen en estudio, utilizándose otro fragmento de DNA
(sonda) complementario a una parte intermedia del DNA que se quiere amplificar. Dicha
sonda lleva acoplada una molécula fluorescente (reporter) y otra molécula que inhibe la
fluorescencia (quencher). De esta forma, cuando la molecula fluorescente es desplazada
por la enzima Taq polimerasa, dicha molécula se libera y emite fluorescencia al ser
iluminada con un laser.
Ilustración 56 Esquema de la RT‐qPCR según la metodología TaqMan (Modificado de
TaqMan Gene expresión Assays Protocol).
La cuantificación de la fluorescencia emitida durante cada ciclo de PCR será proporcional
a la cantidad de DNA que se está amplificando. El detector fotométrico junto con un
programa especial, monitoriza el incremento en la emisión del fluorocromo. El algoritmo
normaliza la señal a un patrón interno (Δ Rn) y automáticamente calcula la línea de corte
del ciclo (Threshold‐CT), cuando el Δ Rn alcanza diez veces la desviación estándar de la
línea base.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
219
Inicialmente, se realizó una curva estándar de validación para cada cebador‐sonda con
diluciones seriadas de varias muestras para asegurar que el final de la reacción (tanto
para muestras control, como para los distintos tratamientos) se encontraba en la parte
media de la curva exponencial de amplificación. Se utilizaron 5,5 μl de cDNA, 4 μl de
Taqman Universal PCR Master Mix (Applied biosystems) y 0,5 μl de cada cebador‐sonda
por cada muestra. También se ensayaron diversos genes de referencia (house keeping
genes) para normalizar los datos (18s, ciclofilina, β‐actina y Gliceraldehido 3‐fosfato
deshidrogenasa), siendo elegidos aquellos que presentaron una menor variación entre
las distintas muestras y tratamientos. En este trabajo, los genes en estudio se refirieron
a los genes 18S, β‐actina y ciclofilina.
Los reactivos para el análisis de expresión génica de los distintos genes en estudio, así
como los genes de referencia son prediseñados y obtenidos de Applied Biosystems
(Foster City, EEUU), y las condiciones experimentales se ajustaron a las indicaciones del
fabricante. La detección y amplificación de los genes específicos se llevó a cabo con el
sistema de detección de secuencias ABI PRISM 7000HT y ABI PRISM 7900HT (Secuence
Detection System, Applied Biosystems).
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
220
Tabla 6 Listado de genes y sondas utilizadas para el análisis de expresión génica
Nombre Símbolo gen Ref sonda TaqMan©
Proteína desacoplante 2 Ucp2 Rn01754856_m1
Receptor activado por el proliferador de peroxisomas γ Pparγ Rn00440945_m1
NADH deshidrogenasa (ubiquinona) Fe‐S proteína 2 Ndufs2Rn01411711_m1
Succinato deshidrogenasa, subunidad C SdhcRn01412110_g1
Ubiquinol‐Cit c reductasa, complejo III (VII) UqcrqRn01467641_g1
Complejo ATP sintasa mitocondrial F1 γ polipept. 1 Atp5c1 Rn01487290_g1
Superóxido dismutasa 2, mitocondrialSod2 Rn00566942_g1
Glutatión peroxidasa GpxRn00577994_g1
Receptor activado por el proliferador de peroxisomas
γ, coactivador 1 alpha Pgc1α Rn00580241_m1
Receptor activado por el proliferador de peroxisomas
γ, coactivador 1 beta Pgc1ß Rn00598552_m1
Factor de respiración nuclear 1 Nrf1 Rn01455958_m1
Sirtuina 1 Sirt1 Rn01428093_m1
Sirtuina 3 Sirt3 Rn01501408_m1
Carnitina palmitoil transferasa 1a, hígado Cpt1 Rn00580702_m1
Receptor activado por el proliferador de peroxisomas α Pparα Rn00566193_m1
Acyl‐Coenzima A deshidrogenasa, cadena larga Acadl Rn00563121_m1
Factor de transcripción regulado por esteroles 1 Srebp Rn01495772_g1
Diacilglicerol O‐aciltransferasa homolog 2 Dgat2 Rn01506785_g1
Acil‐Coenzima A oxidasa 1, palmitoil Acox1 Rn00569216_m1
Β‐Actina Actb Rn00667869_m1
Cytochrome c oxidase II codificación mitocondrial CoxII/Mtco2 Rn03296734_s1
Forkhead box O3 Foxo3a Rn01441087_m1
18S rRNA eucariótico 18s Hs99999901_s1
Ciclofilina Ppia Rn00690933_m1
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
221
Los datos se obtuvieron como valores CT, que es el ciclo en el cual la señal de
fluorescencia emitida se encuentra considerablemente por encima de los niveles de
amplificación inespecífica y es inversamente proporcional al número de copias iniciales
de la muestra. Después, se determinaron los valores de ΔCT (ΔCT=CT del gen en estudio‐
CT del gen de referencia) para cada muestra. Los cambios en la expresión del gen se
calcularon por el método de 2‐ΔΔCT (Perez‐Matute et al 2009).
3.2.15 MEDIDA DE LOS NIVELES DE DIVERSAS PROTEÍNAS Y DE LA ACETILACIÓN DE
Foxo3a y Pgc1β POR INMUNOPRECIPITACIÓN Y WESTERN BLOT
3.2.15.1 Fundamento básico
Para el análisis de los niveles de las proteínas se empleó la técnica de Western blot. Los
nivéles de Sirt1 y Sirt3 se determinaron en extractos protéicos totales, y los de Parp total
y procesada, en extractos de proteícos mitocondriales. Esta técnica se basa en la
separación de proteínas por electroforésis en función de su peso molecular, su posterior
transferencia a membranas y la detección de las proteínas mediante inmunoblot. Los
pasos principales de la técnica se resumen en la Ilustración 65:
Ilustración 57 Pasos principales de la técnica de Western Blot
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
222
3.2.15.2 Reactivos
Buffer de lisis para extracción de proteínas mitocondriales
Tris-HCl 20 mM. pH 8
NaCl 137 mM
Glicerol 10%
Triton 1%
Ortovanadato sódico 1 mM
EDTA 2 mM
PMSF 1 mM
NaF 1 mM
Inhibidores de proteasas 1%
Buffer RIPA
NaH2PO4 8 mM
Na2HPO4 42 mM
SDS 1%
NP40 1%
NaF 1mM
PMSF 1 mM
Ortovanadato sódico 1mM
Deoxioctilglicina 1 mg/ml
Inhibidores de proteasas 1%
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
223
Buffer de carga 2X (tejido)
TrisHCl 1 M (pH 6,7)
MOPS 100 mM
EDTA 10 mM
Glicerol 15 %
SDS 1,5 %
Tritón 0,3%
β‐Mercaptoetanol 10 %
Azul de bromofenol 0,1 %
Buffer de carga 2X (Extractos mitocondriales)
TrisHCl 125 mM (pH 6,7)
Glicerol 20 %
SDS 4 %
β‐Mercaptoetanol 10 %
Azul de bromofenol 0,1 %
Tampón de electroforésis
Tris 25 mM (pH 8,3)
Glicina 192 mM
SDS 0,1%
Tampón de transferencia
Tris 25 mM (pH 8,3)
Glicina 192 mM
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
224
Metanol 20 %
TBS y TBS‐Tween
TrisHCl 20 mM (pH 7,5)
NaCl 150 mM
Tween 20 0,1 % (TBS‐Tween)
Tinción de Coomasie
Azul de Bromofenol 0,15%
Metanol 50 %
Ác. Acético 10%
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
225
Anticuerpos empleados
Tabla 7 Anticuerpos empleados para la determinación de proteinas
Anticuerpo Fabricante Ref Dilución Especificidad
Anticuerpos primarios
Sirtuina 1 Santa Cruz sc15404 1:200 Goat Anti‐rabbit
Sirtuina 3 Santa Cruz sc99143 1:200 Goat Anti‐rabbit
Foxo3a Santa Cruz sc11351 1:100 Goat Anti‐rabbit
Parp (total y
procesada)
Cell Signalling 9542S 1:200 Goat Anti‐rabbit
Acetylated‐Lys Cell Signalling 9441 1:500 Goat Anti‐rabbit
Pgc1β Santa Cruz sc‐13067 1:200 Goat Anti‐rabbit
β‐Actina Sigma‐Aldrich A5316 1:1000 Anti‐mouse
COX I MitoScience MS404 1:1000 Anti‐mouse
Anticuerpos secundarios
Goat antirabbit BioRad 170/6515 1:10000
Goat antimouse Santa Cruz sc‐2031 1:5000
Otros reactivos
Super signal revelation solution (Pierce, Rock‐ ford, Ill., USA)
Inhibidor de proteasas (Sigma‐Aldrich): 104 mM 4‐ (2‐aminoetil)benzenesulfonil
fluorhídrico (AEBSF); 80 µM aprotinina; 4 mM Bestatina; 1,4 mM E‐64; 2 mM leupeptina;
1.5 mM pepstatina
Marcador de peso molecular All Blue y Kaleidoscope (BioRad)
Leche desnatada en polvo
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
226
3.2.15.3 Material y equipos
Microcentrífuga de mesa Eppendorf 5415 R
Sonicador Branson 250
Multiskan spectrum (Thermo Scientific)
Equipo de electroforésis Mini‐Protean tetra system (BioRad)
Equipo de transferencia Mini‐Trans Blot Cell (BioRad)
Fuente PowerPac Basic (BioRad)
Películas de revelado Hyperfilm (Amersham)
Agitador orbital de placas
Densitómetro GS‐800 (Bio Rad Laboratories)
3.2.15.4 Procedimiento
Extracción de proteínas tisulares: para la obtención del extracto de proteínas totales se
pesaron 100 mg de hígado a los que se les añadió 500 µl de Buffer RIPA y se sonicó el
tejido en hielo a una amplitud del 50% y 30 pulsos de 1 segundo. Posteriormente se
incubaron los homogeneizados en hielo durante 30 minutos y se centrifugaron a 13000
g durante 1 hora a 4oC. Posteriormente se recogió el sobrenadante con cuidado de no
arrastrar la capa superior de grasa y se determinó la concentración de proteínas en los
extractos por el sistema de BCA.
Extracción de proteínas mitocondriales: se trataron 200 µl de extracto mitocondrial
con igual volumen de buffer de lisis. Se incubaron en hielo durante 30 minutos y
posteriormente se centrifugaron a 13000 g durante 5 minutos a 5ºC. Se recogió el
sobrenadante en el que se determinó la concentración de proteínas por el método de
Bradford.
Inmunoprecipitación: para determinar los niveles de acetilación de diferentes
proteínas (Foxo3a y Pgc1β) se inmunoprecipitaron las muestras. Para ello, se tomaron
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
227
100 µl de extractos diluidos en solución de lisis. Se añadieron 2 µg de anticuerpo
policlonal anti‐acetylated‐lysine (Cell Signaling), y se dejó incubando dos horas a 4oC, en
agitación. Posteriormente se añadieron a las muestras 20 µl de suspensión de proteína
A/G PLUS‐Agarose (Santa Cruz Biotechnology). Tras incubar la mezcla durante toda la
noche a 4oC y en agitación moderada, se centrifugaron los tubos 2 minutos a 12000g y a
4oC. Se retiró el sobrenadante y se hicieron 4 lavados de la agarosa y los
inmunocomplejos, mediante centrifugación, con 300 µl de solución de lisis, retirando el
sobrenadante cada vez. A continuación, se añadieron sobre la agarosa 20 µl de buffer de
carga 2X (estándar) y se hirvieron las muestras durante 7 minutos, separando así los
inmunocomplejos de la agarosa. Se centrifugó una vez más, durante dos minutos a
12000g a 4oC y se recogió el sobrenadante. Finalmente, hervimos 5 minutos para
desnaturalizar las proteínas y poder cargar en los geles de poliacrilamida. Se cargaron
volúmenes iguales de todas ellas en paralelo para la posterior determinación de
proteína total y acetilada.
Electroforésis: la separación de las proteínas según su peso molecular se realizó
mediante la técnica descrita por Laemmli (Laemmli 1970). Se emplearon geles de
poliacrilamida discontinuos, de 0,75mm de espesor (Acrilamida: N, N’‐
metilenbisacrilamida 37,5:1), constituídos por un gel inferior de separación, al 8%, 10% ó
12% (V/V) de poliacrilamida, según el tamaño de la proteína a estudiar. El porcentaje de
acrilamida del gel superior o gel de apilamiento fue del 5%. Esta menos concentración
de acrilamida permite obtener bandas finas que se resolverán en el gel inferior. Para
cargar las muestras en el gel se mezclaron con solución de carga 2X (tejidos) y se
hirvieron durante 10 minutos a 95oC. De este modo se desnaturalizaron las proteínas y
se favoreció su unión al SDS, detergente aniónico que da forma homogénea y carga
negativamente a las proteínas. Tras enfriar las muestras en hielo y con un breve pulso de
centrifugación, se cargaron entre 50 µg de proteína en cada calle. La electroforésis se
realizó en cubetas (Mini‐Protean tetra system, Bio‐Rad Laboratories), a un voltaje
constante de 80 mV en el superior y de 120 mV en el gel inferior, hasta que el frente de
azul de bromofenol alcanzara el extremo del gel o los marcadores de peso molecular
específicos se separaran suficiente.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
228
Transferencia: las proteínas separadas electroforéticamente en los geles de
poliacrilamida se inmovilizaron en membranas de PVDF previamente activadas en
metanol en una membrana de nitrocelulosa (HybondTM‐P extra, 0,45 micras, Amersham
International). Esta inmovilización se realizó mediante un sistema de transferencia
electroforética húmeda. La transferencia se realizó a 300 mA, durante 3 horas a
temperatura ambiente. Finalizada la transferencia, las membranas se incubaron 2 horas
a temperatura ambiente y en agitación, en solución de bloqueo, para evitar que se
pudiera producir posteriormente adsorción inespecífica de los anticuerpos a la
superficie de nitrocelulosa. Se utilizó como agente bloqueante una solución de leche
desnatada al 5% en TBS‐Tween.
Incubación con anticuerpos: después de bloquear las membranas, se incubaron toda la
noche con los anticuerpos primarios correspondientes a 4º C (Tabla 7), empleando la
dilución recomendada en cada caso por el fabricante. Tras la incubación, se lavaron las
membranas tres veces con TBS‐T y se incubaron durante 60 minutos a temperatura
ambiente con un anticuerpo anti‐IgG conjugado con peroxidada (Tabla 7) y dirigido
contra distintas especies, en función del anticuerpo primario al que debían reconocer.
Por último, las membranas, se sometieron a tres lavados con TBS‐T y un último lavado
con TBS antes de revelar.
Revelado: las bandas de proteína inmunoreactivas se visualizaron mediante
quimioluminiscencia (Super Signal ULTRA kit, Pierce). Para ello se incubó la membrana
con una solución de peróxido de hidrógeno y un substrato (luminol) que emite luz de
longitud de onda de 428 nm al ser oxidado por la peroxidada en presencia de fenoles
que potencian la reacción. Seguidamente se expusieron las membranas a películas
fotográficas sensibles a esta luz (High performance chemiluminescence film, Amersham
HyperfilmTM ECL, GE Healthcare, Reino Unido) durante el tiempo necesario para registrar
la señal. La intensidad de las bandas detectadas se cuantificó utilizando un sistema de
análisis de imagen, que integra la densidad óptica de todos los puntos en el área de la
banda (Densitometer GS‐800, Bio‐Rad Laboratories).
Para realizar la inmunodetección de un segundo epítopo/proteína en una membrana en
la que previamente se hubiera realizado una primera inmunodetección, se retiraron los
anticuerpos unidos a la membrana, para evitar interferencias entre las señales. Para ello
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
229
se añadió a la membrana la solución de stripping (Re‐Blot Plus Mild Solution 10x,
Millipore) y se incubó 15 minutos a temperatura ambiente y en vigorosa agitación.
Seguidamente se hicieron 2 lavados de 15 minutos cada uno con TBS‐T, procediendo a
bloquear la membrana durante 2 horas. Antes de utilizar las membranas se confirmó la
eliminación de los anticuerpos adsorbidos por reincubación con el anticuerpo
secundario y posterior revelado.
3.2.16 ANÁLISIS DE LA PRODUCCIÓN DE ESPECIES REACTIVAS DE OXÍGENO EN
MITOCONDRIAL AISLADAS
La producción de O2*‐ e H2O2 se midió por quimioluminiscencia siguiendo el
procedimiento detallado en los puntos 3.1.5 y 3.1.6 de esta memoria. Los análisis se
realizaron por triplicado en extractos mitocondriales frescos.
3.2.17 DETERMINACIÓN DE LA ACTIVIDAD DE LA CTE: COMPLEJO I
3.2.17.1 Fundamento básico
La medida de la actividad del Complejo I de la CTE se basó en el seguimiento por
colorimetría de las reacciones de redox que cataliza dicho complejo. Este método está
basado en procedimientos previamente descritos en la literatura (Aleardi et al 2005).
Como se resume en la ilustración 56, en este complejo se inicia la transferencia
electrónica mediante la oxidación de NADH a NAD+ (1) transfiriéndose ambos protones a
la CoQ (2) que actúa como aceptor final de la reacción de oxido‐reducción (Tocilescu et
al 2010).
Ilustración 58 Esquema de reacciones para la determinación de la actividad del Complejo I
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
230
3.2.17.2 Reactivos
Tabla 8 Reactivos y concentraciones empleados en la medida de la actividad del Complejo I
Reactivo Stock/Disolvente Buffer
Hepes pH 7,8 20 mM/H2O2 20 mM
KCN 1 M/ Etanol 99% 1 mM
NADH 50 mM/ Hepes 100 µM
Coenzima Q 40 mM/ Etanol 99% 40 µM
Rotenona 0,5 mM/Etanol 99% NO
3.2.17.3 Material y equipos
Vórtex
Multiskan spectrum (Thermo Scientific)
Agitador orbital de placas
3.2.17.4 Procedimiento
Se diluyeron los extractos mitocondriales, previamente descongelados a 4oC, en buffer
Hepes hasta llevarlos a una concentración de 1 µg/µl y se dividieron en dos alícuotas.
A una de las alícuotas, que se empleó como control de oxidación, se le añadió
Rotenona a una concentración final de 10 µM y se incubó durante 5 minutos en hielo.
Se preparó el buffer de reacción y se añadió a las placas de lectura (150 µl/pocillo).
Se añadió con pipeta multicanal 50 µl de muestra (con y sin rotenona) por pocillo,
alcanzando así una concentración de 50 µg de proteína por pocillo. Todas las muestras
se determinaron por triplicado.
Inmediatamente después se agitó la placa protegiéndola de la luz y se procedió a la
lectura.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
231
Parámetros de lectura: longitud de onda 340 nm; tiempo de lectura 10 minutos;
intervalo de medida 10 segundos; temperatura de medida 37oC.
Una vez obtenidos los datos se analizó la parte lineal de la cinética en cada curva y se
calculó la actividad restándole previamente la oxidación debida a factores ambientales
que se expresó en µmoles de NADH/min/mg de proteína. El coeficiente de extinción
molar de NADH a 340 nm y 37oC empleado fue de 6,22 mM‐1*cm‐1.
3.2.18 DETERMINACIÓN DE LA ACTIVIDAD DE LA CTE: COMPLEJO II+III
3.2.18.1 Fundamento básico
La actividad de esto complejos se mide unida debido a las dificultades metodológicas
que implica la medida aislada del complejo III ya que para ello es necesario el empleó de
CoQ reducida altamente reactiva. Por esto se mide la actividad de ambos complejos
juntos y posteriormente la del Complejo II (Succinato deshidrogenasa). Se basa en el
seguimiento por colorimetría del aumento de Cit c reducido (absorbe luz a 551 nm)
asociado a las reacciones catalizadas por el complejo II y III de la CTE.
Ilustración 59 Conjunto de reacciones en las que se basa la determinación de la actividad del
Complejo II+III
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
232
Como se observa en la ilustración 57, el complejo II transforma el succinato en fumarato
cediendo dos protones al FAD (1), acoplada a esta reacción el CoQ pasa a CoQ‐H2 (2). Por
otro lado en el complejo III el CoQ reducido se oxida cediendo sus protones al Cit c que
se reduce, esta última reacción es la que se mide por este método basado en el
procedimiento descrito por Benard et al (2006) (Benard et al 2006) con ligeras
modificaciones.
3.2.18.2 Reactivos
Tabla 9 Reactivos y concentraciones empleados en la medida de la actividad del
Complejo II+III
Reactivo Stock/Disolvente Buffer A Buffer B
Hepes pH 7,8 20 mM/H2O2 20 mM 20 mM
Cit c 1 mM/ Hepes 50 µM 50 µM
KCN 1 M/ Etanol 99∙% 1 mM 1 mM
Succinato 0,5 M/ H2O2 5 mM
3.2.18.3 Material y equipos
Vórtex
Multiskan spectrum (Thermo Scientific)
Agitador orbital de placas
3.2.18.4 Procedimiento
Se diluyeron los extractos mitocondriales, previamente descongelados a 4oC, en buffer
Hepes hasta llevarlos a una concentración de 1 µg/µl.
Se prepararon los bufferes de reacción y se añadió a las placas de lectura (150
µl/pocillo), se realizaron en paralelo las medidas con buffer A y B para cada muestra. El
buffer B se utilizó como control de reducción ambiental del Cit c.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
233
Se añadió con pipeta multicanal 50 µl de muestra por pocillo, alcanzando así una
concentración de 50 µg de proteína por pocillo. Todas las muestras se determinaron por
triplicado.
Inmediatamente después se agitó la placa protegiéndola de la luz y se procedió a la
lectura.
Parámetros de lectura: longitud de onda 551 nm; tiempo de lectura 10 minutos;
intervalo de medida 10 segundos; temperatura de medida 37oC.
Una vez obtenidos los datos se analizó la parte lineal de la cinética en cada curva y se
calculó la actividad restándole previamente la oxidación debida a factores ambientales
que se expresó en µmoles de Cit C reducido/min/mg de proteína. El coeficiente de
extinción molar de Cit C reducido a 551 nm y 37oC empleado fue de 21,5 mM‐1*cm‐1.
3.2.19 DETERMINACIÓN DE LA ACTIVIDAD DE LA CTE: COMPLEJO IV
3.2.19.1 Fundamento básico
La actividad del Complejo IV de la CTE se determinó empleando un kit comercial
(MS444; MitoScience, Eugene, Oregon, USA). El kit se basa en la inmunocaptura del
Complejo IV con un anticuerpo específico, posteriormente se determina la actividad
mediante la monitorización de la oxidación del Cit c catalizada por la enzima, como se
detalla en la ilustración 58:
Ilustración 60 Reacción en la que se basa la medida de la actividad del Complejo IV
3.2.19.2 Procedimiento
Preparación de muestra: tras la descongelación de los extractos mitocondriales a
4oC se centrifugaron a 13000 g durante 10 minutos a 4oC y se descartó el
sobrenadante. El pellet se resuspendió en cinco volúmenes de solución 1 del kit y se
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
234
midió la concentración de proteína ajustándose las muestras a una concentración de
5 mg/ml. Posteriormente, se trató con diez volúmenes de detergente durante 30
minutos en hielo. Pasada la incubación se centrifugaron las muestras a 15000 g
durante 20 minutos a 4oC y se recogió el sobrenadante. Se determinó la
concentración en el sobrenadante y se ajustó con solución 1 a 0,15 µg/µl.
Inmunocaptura: se añadieron 200 µl de muestra y controles positivo y negativo en
los pocillos y se incubó durante 3 horas a temperatura ambiente. Posteriormente se
lavaron los pocillos tres veces.
Medida de la actividad: se añadió el buffer de reacción con Cit c reducido y se
midió la absorbancia a 550 nm durante 2 horas a 30oC cada 2 minutos. Todas las
medidas se realizaron por duplicado.
3.2.20 DETERMINACIÓN DE LA ACTIVIDAD DE LA CTE: COMPLEJO V
3.2.20.1 Fundamento básico
La actividad del Complejo V de la CTE se determinó empleando un kit comercial (MS543;
MitoScience, Eugene, Oregon, USA). Este kit comercial se basa en la capacidad de la ATP
sintasa para actuar en sentido reverso, es decir, en su habilidad para hidrolizar el ATP a
ADP y fosfato (1), en ausencia del gradiente de protones (Feniouk, Suzuki and Yoshida
2007, Lotscher, de Jong and Capaldi 1984). Como se muestra en la ilustración 59, dicha
reacción esta acoplada a la desfosforilación de fosfoenolpiruvato (PEP) a piruvato,
catalizada por la piruvato quinasa (PK) (2). A su vez, el piruvato es responsable de la
oxidación de NADH a NAD+ catalizada por la lactato deshidrogenasa (LDH) (3) que puede
ser monitorizada mediante la disminución en la absorbancia a 340 nm.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
235
Ilustración 61 Reacciones implicadas en la medida de la actividad ATP sintasa por el
método de Lotscher
Para un correcto desarrolló de este método son necesarias diferentes modificaciones
descritas previamente (Terni et al 2010). Así se añadió al medio oligomicina para evitar
la síntesis de ATP desde el ADP hidrolizado, se inmunocapturó la subunidad F1 de la ATP
sintasa principal responsable de la hidrólisis (Itoh et al 2004), y por último, se empleó en
el medio determinados lípidos para conseguir la reestructuración funcional del complejo
(Cao et al 2001).
3.2.20.2 Procedimiento
Preparación de muestra: tras la descongelación de los extractos mitocondriales a
4oC se centrifugaron a 13000 g durante 10 minutos a 4oC y se descartó el
sobrenadante. El pellet se resuspendió en dos volúmenes de solución 1 del kit y se
midió la concentración de proteína ajustándose las muestras a una concentración de
5 mg/ml. Posteriormente se trató con diez volúmenes de detergente durante 30
minutos en hielo. Pasada la incubación se centrifugaron las muestras a 15000 g
durante 20 minutos a 4oC y se recogió el sobrenadante. Se determinó la
concentración en el sobrenadante y se ajustó con solución 1 a 1 µg/µl.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
236
Inmunocaptura y reestructuración funcional: se añadieron 50 µl de muestra y
controles positivo y negativo en los pocillos y se incubaron durante 3 horas a
temperatura ambiente. Posteriormente se lavaron los pocillos dos veces. Se
añadieron 40 µl de mix lipídico y se incubó durante 45 minutos a temperatura
ambiente.
Medida de la actividad: se añadió el buffer de reacción que contenía la PK y la
LDH, así como el piruvato y el NADH, y se midió la absorbancia a 340 nm durante 2
horas a 30oC cada 2 minutos. Todas las medidas se realizaron por duplicado.
3.2.21 ANÁLISIS DE LA ACTIVIDAD DE ENZIMAS DEL CK: SUCCINATO DESHIDROGENASA
3.2.21.1 Fundamento básico
La importancia de la valoración de la actividad de la succinato deshidrogenasa es doble
ya que además de indicarnos el funcionamiento de la CTE nos proporciona información
acerca de la actividad del Ciclo de Krebs. Al igual que en los casos anteriores el método
se basó en el seguimiento por colorimetría de las reacciones redox que cataliza dicho
complejo.
Ilustración 62 Reacciones catalizadas por la SDH y en las que se basa la medida de su
actividad
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
237
Este método está basado en procedimientos previamente descritos en la literatura
(Cimen et al 2010, Finley et al 2011) con ligeras modificaciones. Como se resume en la
ilustración 60, la SDH cataliza las reacciones redox que se dan para la transformación de
succinato a fumarato en el CK, en este paso el poder reductor se concentra en el FADH2
(1). Posteriormente el FADH2 transfiere ambos protones a la CoQ (2) que los cede al 2,6‐
diclorofenolindofenol (DCPIP) oxidado reduciéndolo (3).
3.2.21.2 Reactivos
Tabla 10 Reactivos empleados en la determinación de la actividad del Complejo II
3.2.21.3 Material y equipos
Vórtex
Multiskan spectrum (Thermo Scientific)
Agitador orbital de placas
3.2.21.4 Procedimiento
Se diluyeron los extractos mitocondriales, previamente descongelados a 4oC, en buffer
Hepes hasta llevarlos a una concentración de 1 µg/µl y se dividieron en dos alícuotas.
A una de las alícuotas, que se empleó como control de oxidación, se le añadió 4,4,4‐
Trifluoro‐1,2‐Trienil‐1,3‐butadienona (TTFA), inhibidor de la SDH, a una concentración
final de 100 µM y se incubó durante 5 minutos en hielo.
Reactivo Stock/Disolvente Buffer
Hepes pH 7,8 20 mM/H2O2 20 mM
KCN 1 M/ Etanol 99% 1 mM
Succinato 1 M/ H2O2 5 mM
Coenzima Q 40 mM/ Etanol 99% 40 µM
Rotenona 1 mM/Etanol 99% 1 µM
DCPIP 16 mM/ H2O2 16 µM
TTFA 10 mM/ Etanol 99% NO
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
238
Se preparó el buffer de reacción y se añadió a las placas de lectura (150 µl/pocillo).
Se añadió con pipeta multicanal 50 µl de muestra (con y sin TTFA) por pocillo,
alcanzando así una concentración de 50 µg de proteína por pocillo. Todas las muestras
se determinaron por triplicado.
Inmediatamente después se agitó la placa protegiéndola de la luz y se procedió a la
lectura.
Parámetros de lectura: longitud de onda 600 nm; tiempo de lectura 15 minutos;
intervalo de medida 10 segundos; temperatura de medida 37oC.
Una vez obtenidos los datos, se analizó la parte lineal de la cinética en cada curva y se
calculó la actividad restándole previamente la oxidación debida a factores ambientales
que se expresó en µmoles de DCPIP/min/mg de proteína. El coeficiente de extinción
molar de DCPIP a 600 nm y 37oC empleado fue de 21 mM‐1*cm‐1.
3.2.22 ANÁLISIS DE LA ACTIVIDAD DE ENZIMAS DEL CK: CITRATO SINTASA
3.2.22.1 Fundamento básico
La CS es la primera enzima que participa en el ciclo de Krebs, su actividad se emplea
para valorar tanto el funcionamiento del CK como para estimar la masa mitocondrial de
un tejido mediante el ratio entre la actividad CS total, medida en todo el tejido, y CS
específica, medida en extractos mitocondriales (Raffaella et al 2008). La actividad se
midió por la monitorización colorimétrica de las siguientes reacciones:
Ilustración 63 Reacciones implicadas en la medición de la actividad citrato sintasa
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
239
Como se aprecia en la ilustración 61, la CS cataliza la reacción del OAA con el AcCoA
transformándose en citrato y CoA SH. Este último es capaz de reaccionar con el DTNB
produciendo TNB que absorbe luz a una longitud de onda de 412 nm, de tal manera que
la monitorización de la absorbancia a 412 nm es una medida indirecta de la actividad de
la enzima.
3.2.22.2 Reactivos
Tabla 11 Concentración de los reactivos empleados en la medida de la actividad citrato
sintasa
Reactivo Stock/Disolvente Buffer A Buffer B
Hepes pH 7,8 20 mM/H2O2 20 mM 20 mM
DTNB 1 mM/ TrisHCl pH 8 0,1 mM 0,1 mM
Acetil CoA 20 mM/ H2O2 0,4 mM 0,4 mM
Oxalacetato 10 mM/ H2O2 0,5 mM NO
3.2.22.3 Material y equipos
Vórtex
Multiskan spectrum (Thermo Scientific)
Agitador orbital de placas
Calibrador de pH
3.2.22.4 Procedimiento
Se diluyeron los extractos mitocondriales, previamente descongelados a 4oC, en buffer
Hepes hasta llevarlos a una concentración de 1 µg/µl.
Se pesaron los tejidos congelados y se homogeneizaron en buffer Hepes, después se
diluyeron a una concentración de 1 µg/µl.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
240
Se prepararon los bufferes de reacción y se añadió a las placas de lectura (150
µl/pocillo), se realizaron en paralelo las medidas con buffer A y B para cada muestra. El
buffer B se utilizó como control de reducción ambiental del DTNB.
Se añadió con pipeta multicanal 50 µl de muestra por pocillo, alcanzando así una
concentración de 50 µg de proteína por pocillo. Todas las muestras se determinaron por
triplicado.
Inmediatamente después se agitó la placa protegiéndola de la luz y se procedió a la
lectura.
Parámetros de lectura: longitud de onda 412 nm; tiempo de lectura 10 minutos;
intervalo de medida 10 segundos; temperatura de medida 37oC.
Una vez obtenidos los datos se analizó la parte lineal de la cinética en cada curva y se
calculó la actividad restándole previamente la oxidación debida a factores ambientales
que se expresó en µmoles de TNB /min/mg de proteína. El coeficiente de extinción
molar del TNB reducido a 412 nm y 37oC empleado fue de 14,17 mM‐1*cm‐1.
Una vez obtenidas las actividades de CS total y CS específica para cada muestra se
valoró la masa mitocondrial mediante el ratio entre ambas.
3.2.23 ESTUDIO DE LA PRODUCCIÓN DE ATP POR BIOLUMINISCENCIA
3.2.23.1 Fundamento básico
Se determinaron los niveles de ATP pre existente en las muestras empleando un kit
comercial (ATP Determination (sensitive assay), Proteinkinase) basado en la reacción de
la lucigenina con el ATP catalizada por la luciferasa que fue descrito por primera vez por
Lemasters et al (1976) (Lemasters and Hackenbrock 1976), como se detalla en la
siguiente figura:
LuzCOoPirofosfatAMPinaOxyluciferOATPLucigenina MgLuciferasa
22
2
Ilustración 64 Reacción en la que se basa la medida de los niveles de ATP por
bioluminiscencia
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
241
Para la correcta determinación de los niveles de ATP fue necesario extraer el ATP de la
matriz mitocondrial.
3.2.23.2 Reactivos
Buffer Hepes 20 mM, pH 7,8
Ácido perclórico 1M
KOH 2M
Tris HCl 100 mM, pH 7,8
Adenosine 5´‐trifosfato sal disódica
DTT
Luciferasa de luciérnaga
D‐Luciferina
Buffer de reacción
3.2.23.3 Material y equipos
Vórtex
Agitador orbital de placas
Calibrador de pH
Microcentrífuga de mesa Eppendorf 5415 R
Luminoskan Ascent (Thermolab System)
3.2.23.4 Procedimiento
Extracción del ATP de la matriz mitocondrial de acuerdo al protocolo de Dorta et
al (2005) (Dorta et al 2005): tras la descongelación de las muestras a 4oC se llevaron a
una concentración de 1 mg/ml con Buffer Hepes y se centrifugaron a 9000 g durante
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
242
5 minutos a 4oC, se descartó el sobrenadante y el pellet se resuspendio en ác.
perclórico. Se volvieron a centrifugar las muestras a 14000 g durante 5 minutos a 4oC,
se recogieron 100 µl de sobrenadante y se neutralizaron añadiendo 70 µl de KOH 2M,
se llevaron a un volumen final de 1 ml con Tris HCl y se centrifugaron las muestras de
nuevo a 14000 g durante 5 minutos a 4oC. En el sobrenadante se determinó la
concentración de ATP.
Medida del contenido en ATP: se preparó una curva de calibración de ATP en cada
una de las placas con concentraciones entre 10‐14 y 10‐7 M. Se añadieron a la placa 25
µl de las muestras o del patrón y 25 µl de un buffer que contenía la D‐lucigenina,
luciferasa y DTT. Se agitó la placa protegida de la luz durante 10 segundos y se incubó
a temperatura ambiente durante 10 minutos, después de la incubación se realizó una
lectura de la placa en un luminometro Luminoskan Ascent. Para el calculó de los
datos se realizó una transformación logarítmica tanto de la curva como de los valores
de la muestra y se calcularon las concentraciones extrapolando a la curva de
calibración y llevando a cabo las transformaciones matemáticas necesarias. Todas las
muestras se midieron por triplicado.
3.2.24 VALORACIÓN DEL DAÑO OXIDATIVO DEL DNA MITOCONDRIAL POR RT‐QPCR
Para determinar el daño inducido por ROS en el mtDNA se procedió a la amplificación
mediante RT‐qPCR de dos fragmentos, uno corto de 79 pb (posiciones 260 a 339) y otro
largo de 161 pb (posiciones 260 a 421) de la misma región del mtDNA, conforme a lo
descrito por Martinéz‐Redondo et al (2010) (Martinez‐Redondo et al 2010) con ligeras
modificaciones.
Este método se basa en que cuando hay un daño en el mtDNA hay un menor número de
copias viables para la amplificación del fragmento largo que del corto, por lo que el valor
de CT del fragmento largo es mayor que el del fragmento corto.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
243
Ilustración 65 Determinación del daño en el mtDNA mediante RT‐qPCR
El kit utilizado para ello fue el SYBR Green qPCR SuperMix‐UDG+ROX (Invitrogen). La
reacción fue seguida por la detección de fluorescencia emitida por fluoróforo SYBR
Green que posee una excelente sensibilidad en la cuantificación de las secuencia diana.
Los oligonucleótidos empleados se obtuvieron en Sigma Aldrich (Sigma Aldrich) y las
secuencias fueron:
HVII‐FOR260: 5´‐GCCACTTTCCACACAGACATCATA‐3´
HVII‐L421: 5´‐AGTGCATACCGCCAAAA GATAAA‐3´
HVII‐C339: 5´‐TGTTTAAGTGCTGTGGCCAGA‐3´
La reacción de amplificación del fragmento largo se llevó a cabo en un volumen final de
10 µl, con 15 ng de cDNA, 5 µl de SYBR Green Mix y una concentración 10 µM de HVII‐
FOR260 y de HVII‐L421. EL programa de amplificación empleado fue 2 minutos a 50oC,
10 minutos a 95oC y 40 ciclos (15 segundos a 95oC, 1 minuto a 60oC).
La reacción de amplificación del fragmento corto se llevó a cabo en un volumen final de
10 µl, con 15 ng de cDNA, 5 µl de SYBR Green Mix y una concentración 2,5 µM de HVII‐
FOR260 y de HVII‐L421. EL programa de amplificación empleado fue 2 minutos a 50oC,
10 minutos a 95oC y 40 ciclos (15 segundos a 95oC, 1 minuto a 60oC).
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
244
Todas las amplificaciones se llevaron a cabo con los sistemas de detección de secuencias
ABI PRISM 7000HT y ABI PRISM 7900HT (Secuence Detection System, Applied
Biosystems) y se realizaron por triplicado.
El calculó absoluto del daño oxidativo del mtDNA se calculó como el ratio entre las
copias del fragmento largo y las del fragmento corto.
3.2.25 ESTUDIO DE LA BIOGÉNESIS MITOCONDRIAL
El estudio de la biogénesis mitocondrial se basó en el análisis de la expresión génica por
RTqPCR descrito anteriormente, de un gen codificado por el mtDNA y dependiente de la
maquinaria genética mitocondrial para su transcripción y traducción, en este estudio el
gen elegido fue el Mtco2 que codifica para la subunidad II del Complejo IV de la CTE. La
expresión de este gen se corrigió por los niveles de mRNA de un gen nuclear endógeno,
en nuestro caso el 18s, empleándose este ratio como el número de copias de mtDNA y
una aproximación fiable de la población mitocondrial del tejido (Guo et al 2011, Pagel‐
Langenickel et al 2007).
3.2.26 ANÁLISIS ESTADÍSTICO
La normalidad de todos los datos se comprobó mediante los test de Shapiro‐Wilk y
Kolmogorof‐Smirnov, y en función de la misma se evaluaron los datos de forma
paramétrica o no paramétrica. Por otro lado se analizaron los posibles outlayers (simples
y extremos) con el programa de análisis estadístico SPSS para Windows versión 15.0
(SPSS Inc. Chicago, Estados Unidos).Para valorar los efectos del tipo de dieta y del
tratamiento con AL así como el efecto independiente de la disminución en la ingesta se
realizó un Anova de una vía seguido de un test post‐hoc de comparaciones múltiples de
Bonferroini o su equivalente no paramétrico el test de Kruskall Wallis con un test post‐
hoc de Dunns. Para el análisis de correlaciones entre parámetros funcionalmente
relacionados se determinaron los coeficientes de correlación de Pearson o Spearman en
función de las pruebas de normalidad respectivas. El nivel de significación estadística fue
establecido para una probabilidad P<0,05. Para la realización de todos los análisis
estadísticos se utilizó el programa GraphPad Prism 5.0 (Graph Pad Software, San Diego,
CA).
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
245
3.3 REFERENCIAS BIBLIOGRÁFICAS
Aleardi AM, Benard G, Augereau O, Malgat M, Talbot JC, Mazat JP, Letellier T, Dachary‐
Prigent J, Solaini GC and Rossignol R. (2005). Gradual alteration of mitochondrial
structure and function by beta‐amyloids: importance of membrane viscosity changes,
energy deprivation, reactive oxygen species production, and cytochrome c release. J
Bioenerg Biomembr. 37, 207‐25.
Benard G, Faustin B, Passerieux E, Galinier A, Rocher C, Bellance N, Delage JP, Casteilla L,
Letellier T and Rossignol R. (2006). Physiological diversity of mitochondrial oxidative
phosphorylation. Am J Physiol Cell Physiol. 291, C1172‐82.
Cao NJ, Brusilow WS, Tomashek JJ and Woodbury DJ. (2001). Characterization of
reconstituted Fo from wild‐type Escherichia coli and identification of two other fluxes
co‐purifying with Fo. Cell Biochem Biophys. 34, 305‐20.
Cimen H, Han MJ, Yang Y, Tong Q, Koc H and Koc EC. (2010). Regulation of succinate
dehydrogenase activity by Sirt3 in mammalian mitochondria. Biochemistry (Mosc). 49,
304‐11.
Chance B and Williams GR. (1956). The respiratory chain and oxidative phosphorylation.
Adv Enzymol Relat Subj Biochem. 17, 65‐134.
Dorta DJ, Pigoso AA, Mingatto FE, Rodrigues T, Prado IM, Helena AF, Uyemura SA, Santos
AC and Curti C. (2005). The interaction of flavonoids with mitochondria: effects on
energetic processes. Chem Biol Interact. 152, 67‐78.
Feniouk BA, Suzuki T and Yoshida M. (2007). Regulatory interplay between proton motive
force, ADP, phosphate, and subunit epsilon in bacterial ATP synthase. J Biol Chem. 282,
764‐72.
Finley LW, Haas W, Desquiret‐Dumas V, Wallace DC, Procaccio V, Gygi SP and Haigis MC.
(2011). Succinate dehydrogenase is a direct target of sirtuin 3 deacetylase activity. PLoS
ONE. 6, e23295.
Garcia‐Campaña A, Baeyens W, Zhang X, Alés F and Gámiz L. (2001). Unfamiliar though
exciting analytical detection in flowing streams: chemiluminescence. Ars Pharmaceutica.
42, 81‐107.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
246
Gonzalez‐Muniesa P, Milagro FI, Campion J and Martinez JA. (2006). Reduction in energy
efficiency induced by expression of the uncoupling protein, UCP1, in mouse liver
mitochondria. Int J Mol Med. 17, 591‐7.
Guo J, Zheng L, Liu W, Wang X, Wang Z, French AJ, Kang D, Chen L and Thibodeau SN.
(2011). Frequent truncating mutation of TFAM induces mitochondrial DNA depletion
and apoptotic resistance in microsatellite‐unstable colorectal cancer. Cancer Res. 71,
2978‐87.
Hinkle PC. (2005). P/O ratios of mitochondrial oxidative phosphorylation. Biochim Biophys
Acta. 1706, 1‐11.
Itoh H, Takahashi A, Adachi K, Noji H, Yasuda R, Yoshida M and Kinosita K. (2004).
Mechanically driven ATP synthesis by F1‐ATPase. Nature. 427, 465‐8.
Kim MS, Park JY, Namkoong C, Jang PG, Ryu JW, Song HS, Yun JY, Namgoong IS, Ha J, Park
IS, Lee IK, Viollet B, Youn JH, Lee HK and Lee KU. (2004). Anti‐obesity effects of alpha‐
lipoic acid mediated by suppression of hypothalamic AMP‐activated protein kinase. Nat
Med. 10, 727‐33.
Laemmli UK. (1970). Cleavage of structural proteins during the assembly of the head of
bacteriophage T4. Nature. 227, 680‐5.
Lemasters JJ and Hackenbrock CR. (1976). Continuous measurement and rapid kinetics of
ATP synthesis in rat liver mitochondria, mitoplasts and inner membrane vesicles
determined by firefly‐luciferase luminescence. Eur J Biochem. 67, 1‐10.
Li Y, Stansbury KH, Zhu H and Trush MA. (1999). Biochemical characterization of lucigenin
(Bis‐N‐methylacridinium) as a chemiluminescent probe for detecting intramitochondrial
superoxide anion radical production. Biochem Biophys Res Commun. 262, 80‐7.
Li Y, Zhu H and Trush MA. (1999). Detection of mitochondria‐derived reactive oxygen
species production by the chemilumigenic probes lucigenin and luminol. Biochim
Biophys Acta. 1428, 1‐12.
Lotscher HR, deJong C and Capaldi RA. (1984). Interconversion of high and low
adenosinetriphosphatase activity forms of Escherichia coli F1 by the detergent
lauryldimethylamine oxide. Biochemistry (Mosc). 23, 4140‐3.
Martinez‐Redondo D, Marcuello A, Casajus JA, Ara I, Dahmani Y, Montoya J, Ruiz‐Pesini E,
Lopez‐Perez MJ and Diez‐Sanchez C. (2010). Human mitochondrial haplogroup H: the
highest VO2max consumer‐‐is it a paradox? Mitochondrion. 10, 102‐7.
Capítulo 3 Material y Métodos Chapter 3 Material and Methods
247
Mytilineou C, Kramer BC and Yabut JA. (2002). Glutathione depletion and oxidative stress.
Parkinsonism Relat Disord. 8, 385‐7.
Okajima T and Ohsaka T. (2003). Chemiluminescence of lucigenin by electrogenerated
superoxide ions in aqueous solutions. Luminescence. 18, 49‐57.
Onyango IG and Khan SM. (2006). Oxidative stress, mitochondrial dysfunction, and stress
signaling in Alzheimer's disease. Curr Alzheimer Res. 3, 339‐49.
Ozdemir G, Ozden M, Maral H, Kuskay S, Cetinalp P and Tarkun I. (2005). Malondialdehyde,
glutathione, glutathione peroxidase and homocysteine levels in type 2 diabetic patients
with and without microalbuminuria. Ann Clin Biochem. 42, 99‐104.
Pagel‐Langenickel I, Schwartz DR, Arena RA, Minerbi DC, Johnson DT, Waclawiw MA,
Cannon RO, 3rd, Balaban RS, Tripodi DJ and Sack MN. (2007). A discordance in
rosiglitazone mediated insulin sensitization and skeletal muscle mitochondrial
content/activity in Type 2 diabetes mellitus. Am J Physiol Heart Circ Physiol. 293, 2659‐
66.
Perez‐Echarri N, Perez‐Matute P, Marcos‐Gomez B, Marti A, Martinez JA and Moreno‐Aliaga
MJ. (2009). Down‐regulation in muscle and liver lipogenic genes: EPA ethyl ester
treatment in lean and overweight (high‐fat‐fed) rats. J Nutr Biochem. 20, 705‐14.
Perez‐Matute P, Neville MJ, Tan GD, Frayn KN and Karpe F. (2009). Transcriptional control
of human adipose tissue blood flow. Obesity (Silver Spring). 17, 681‐8.
Raffaella C, Francesca B, Italia F, Marina P, Giovanna L and Susanna I. (2008). Alterations in
hepatic mitochondrial compartment in a model of obesity and insulin resistance. Obesity
(Silver Spring). 16, 958‐64.
Shen W, Liu K, Tian C, Yang L, Li X, Ren J, Packer L, Head E, Sharman E and Liu J. (2008).
Protective effects of R‐alpha‐lipoic acid and acetyl‐L‐carnitine in MIN6 and isolated rat
islet cells chronically exposed to oleic acid. J Cell Biochem. 104, 1232‐43.
Terni B, Boada J, Portero‐Otin M, Pamplona R and Ferrer I. (2010). Mitochondrial ATP‐
synthase in the entorhinal cortex is a target of oxidative stress at stages I/II of
Alzheimer's disease pathology. Brain Pathol. 20, 222‐33.
Tocilescu MA, Fendel U, Zwicker K, Drose S, Kerscher S and Brandt U. (2010). The role of a
conserved tyrosine in the 49‐kDa subunit of complex I for ubiquinone binding and
reduction. Biochim Biophys Acta. 1797, 625‐32.
Chapter 3 Material and Methods Capítulo 3 Material y Métodos
248
Ukeda H, Maeda S, Ishii T and Sawamura M. (1997). Spectrophotometric assay for
superoxide dismutase based on tetrazolium salt 3'‐‐1‐‐(phenylamino)‐carbonyl‐‐3, 4‐
tetrazolium]‐bis(4‐methoxy‐6‐nitro)benzenesulfonic acid hydrate reduction by xanthine‐
xanthine oxidase. Anal Biochem. 251, 206‐9.
CAPITULO 4 / CHAPTER 4
Resultados/ Results
CAPÍTULO 4.1 /CHAPTER 4.1
Vitamin C, Resveratrol and Lipoic acid actions on
isolated rat liver mitochondria: all antioxidants but
different.
Published in Redox Report. 2010;15 (5):207‐16.
Chapter 4 Results I Capítulo 4 Resultados I
253
4.1 VITAMIN C, RESVERATROL AND LIPOIC ACID ACTIONS ON ISOLATED RAT LIVER
MITOCHONDRIA.
Capítulo 4 Resultados I Chapter 4 Results I
254
4.1.1 SUMMARY
Modulating mitochondrial antioxidant status is a nutritional issue of great interes in the
treatment or prevention of several oxidative stress related diseases such us obesity. Thus,
the aim of the present study was to analyze the effects of three antioxidants on hepatic
mitochondrial function and antioxidant status. Isolated rat liver mitochondria were
incubated with Vitamin C, Resveratrol and Lipoic Acid. The activity of antioxidant enzymes
(manganese superoxide dismutase and glutathione peroxidase), ROS generation and
respiratory parameters (RCR, P/O ratio and respiratory states) were measured. Vitamin C
influenced mitochondrial function by decreasing of ROS generation (P<0.0001), by
stimulating the activity of the manganese superoxide dismutase (197.60±35.99%; P<0.001)
as well as glutathione peroxidase (15.70±5.76%, P<0.05) and by altering the activity of the
electron transport chain, mainly by decreasing the P/O ratio (P<0.05). Resveratrol induced a
significant increase in manganese superoxide dismutase activity (160±11.78%, P<0.0001)
and a decrease in ROS generation (P<0.05‐P<0.0001). By contrast, lipoic acid inhibited the
glutathione peroxidase activity (16.48±3.27%, P<0.05) and induced the uncoupling of the
electron transport chain (P<0.01). Moreover, this antioxidant induced a strong decrease on
P/O ratio (P<0.05‐P<0.0001). In conclusion, our results suggest that the three tested
antioxidants produced direct effects on mitochondrial function, although the magnitude
and intensity of these actions were significantly different, which may have implications
when administrated as antioxidants.
Keywords: antioxidant; mitochondria; oxidative stress; reactive oxygen species
Abreviations: DHLA, dihydrolipoic acid; DIO, diet induced obesity; ETC, electron transport
chain; Gpx, glutathione peroxidase; GR, glutathione reductase; GSH, reduced glutathione;
GSSG, oxidized glutathione; H2O2, hydroperoxide; IRLM, isolated rat liver mitochondria; LA,
lipoic acid; Sod2, manganese superoxide dismutase; O2●, superoxide anion; OXPHOS,
oxidative phosphorylation; RCR, respiratory control ratio; ROS, reactive oxygen species;
RSV, resveratrol; VC; vitamin C.
Chapter 4 Results I Capítulo 4 Resultados I
255
RESUMEN
La modulación del estado antioxidante mitocondrial para el tratamiento o la prevención de
enfermedades relacionadas con un incremento del estrés oxidativo como la obesidad, es un
campo de creciente interés desde el punto de vista nutricional. Así, el objetivo del presente
estudio es analizar en el hígado los efectos de tres antioxidantes sobre la función
mitocondrial y el estado antioxidante. Para ello, mitocondrias aisladas de hígado de rata se
incubaron con Vitamina C, Resveratrol y Ácido Lipoico. Se midieron las actividades de las
enzimas antioxidantes (manganeso superóxido dismutasa y glutatión peroxidasa), la
producción de ROS y diversos parámetros respiratorios (RCR, ratio P/O y el consumo de
oxígeno en los estados respiratorios). La VC produjo una disminución en la producción de
ROS (P<0.0001), mediante la estimulación de la actividad de la Sod2 (197.60±35.99%;
P<0.001) así como de la Gpx (15.70±5.76%, P<0.05) y por la variación de la actividad de la
cadena de transporte de electrones, principalmente por la disminución del ratio P/O
(P<0.05). El Resveratrol produjo un aumento significativo de la actividad Sod2 (160±11.78%,
P<0.0001) y un descenso en la producción de ROS (P<0.05‐P<0.0001). Por el contrario, el
ácido lipoico inhibió la Gpx (16.48±3.27%, P<0.05) e indujo el desacoplamiento de la cadena
de transporte de electrones (P<0.01). Además, este antioxidante indujo un fuerte descenso
en el ratio P/O (P<0.05‐P<0.0001). Nuestros resultados sugieren que los tres antioxidantes
testados ejercen efectos directos en la función mitocondrial, aunque la magnitud y la
intensidad de estas acciones es significativamente diferente para cada uno, lo cual debe
tenerse en cuenta cuando se administran como antioxidantes.
Capítulo 4 Resultados I Chapter 4 Results I
256
4.1.2 INTRODUCTION
Oxidative stress has been generating much recent interest mainly because of its accepted
role as a major contributor to the aetiology of several pathologies with serious public health
implications such as obesity (Valdecantos, Perez‐Matute and Martinez 2009), diabetes
(Rahangdale et al 2009) or metabolic syndrome (Roberts and Sindhu 2009). Oxidative
stress can result from imbalance between reactive species production and antioxidant
defenses (Vincent et al 2006). Mitochondrion is a major cellular site involved in energy
metabolism, and it is also the main source of reactive oxygen species (ROS). In order to
counterbalance the negative effects of ROS, mitochondria also contain enzymatic
antioxidant defenses, such as manganese superoxide dismutase (Sod2) and glutathione
peroxidase (Gpx) (Yu 1994).
The attenuation or complete suppression of oxidative stress as a way to improve several
diseases has flourished as one of the main challenges of research in the last years. Several
approaches have been carried out in order to either decrease the high levels of ROS
generated or boost the endogenous levels of antioxidants. Thus, numerous trials have
examined the effects of supplementation with different antioxidants on oxidative stress
(Ratnam et al 2006, Flora 2007). In this context, multiple lines of evidence suggest that
vitamin C (VC), a hydrophilic vitamin, resveratrol (RSV), a natural poliphenol, and α‐lipoic
acid (LA), a short chain fatty acid, have beneficial effects on several pathologies related to
oxidative stress.
Particularly, a recent study showed a reduction on body weight gain and fat depots after
supplementation with VC (Garcia‐Diaz et al 2007). On the other hand, Baur et al (2006)
described the beneficial effects of RSV on lifespan in obese mouse (Baur et al 2006).
Finally, Prieto‐Hontoria et al (2009) demonstrated significant anti‐obesity effects of LA in a
diet induced obesity rat model (DIO) (Prieto‐Hontoria 2009).
More specifically, these antioxidants showed direct effects on mitochondria. Thus, a recent
study by Lowes et al (2010) demonstrated the key role of vitamin C on mitochondrial
function (Lowes, Webster and Galley).The beneficial effects of RSV on mitochondrial
function have been recently discussed in different research articles (Brookins Danz et al
2009, Robb et al 2008a, Rubiolo and Vega 2008) and LA has also been known as an essential
Chapter 4 Results I Capítulo 4 Resultados I
257
cofactor for mitochondrial bioenergetics enzymes (Smith et al 2004) corroborating its role
in mitochondria.
Thus, this research attempted to address, apparently for the first time, the in vitro effects
of VC, RSV and LA on mitochondrial function by measuring the electron transport status,
the efficiency of oxidative phosphorylation (OXPHOS), ROS production and the activity of
the main mitochondrial antioxidant enzymes.
4.1.3 MATERIALS AND METHODS
4.1.3.1 Animals
Thirteen male Wistar rats (12 weeks old) weighting between 270 to 290 g (281.6±3.76 g)
were supplied by the Applied Pharmacobiology Research Center (CIFA, Pamplona, Spain).
The animals were housed in cages in a temperature controlled room (22 ± 2ºC) with a 12:12
h light:dark cycle. Food and water were given ad libitum. All procedures were performed
according to national and institutional guidelines of the Animal Care and Use Committee at
the University of Navarra. Different animals were used to provide liver mitochondria for the
measurements of respiratory parameters (n=6) than those used for measurements of ROS
production and enzymatic activities (n=7).
4.1.3.2 Materials
ADP, succinate, rotenone, carbonyl cyanide p‐trifluoromethoxyphenylhydrazone (FCCP),
lucigenin, luminol, ascorbic acid, RSV and α‐LA were obtained from Sigma‐Aldrich Chemical
Co (Saint Louis, MO).
The concentrations used for the different antioxidants were calculated based on previous in
vitro studies (Qu et al 2001, Sagun, Carcamo and Golde 2005, Zhang, Fu and Zhou 2004,
Rubiolo and Vega 2008, Robb et al 2008a, Morkunaite‐Haimi et al 2003, Lee et al 2009).
Thus, 30 μM for vitamin C and lipoic acid and 50 μM for resveratrol were used. In particular,
the concentration of RSV is slightly higher than the other two antioxidants since previous
studies developed in primary rat hepatocytes have shown that the main effects of RSV were
observed when using concentrations equal or higher to 50 μM (Rubiolo, Mithieux and Vega
2008). RSV and LA have been diluted in ethanol and an equal concentration of ethanol was
added to the control. On the other hand, VC was diluted in water and an equal
concentration of water was also added to its correponding control.
Capítulo 4 Resultados I Chapter 4 Results I
258
4.1.3.3 Mitochondrial preparations
Mitochondria were isolated by differential centrifugation as previoulsy described Rickwood
et al. (Rickwood, Darley‐Usmar and Wilson 1987), with minor modifications (Gonzalez‐
Muniesa et al 2006). After sacrificing the animals by decapitation, livers were carefully
minced with scissors and rinsed thoroughly in an isolation buffer (10 ml/g tissue) containing
250 mM sucrose, 1 mM EDTA and 5 mM NaTES, pH=7.4. The tissue was further
homogenized in a Potter Elvehjem homogenizer. The homogenate was centrifuged for 10
minutes at 3000 g. The pellet was discarded and the supernatant was recollected and
centrifuged for 10 minutes at 14500 g. The mitochondrial pellet was resuspended in buffer
2 which contained 250 mM sucrose, 5 mg/ml BSA free fatty acids and 5 mM NaTES, pH=7.4.
The homogenate was again centrifuged for 10 minutes at 3000 g and the supernatant was
also centrifuged for 10 minutes at 14500 g. The mitochondrial pellet was carefully
resuspended in a minimal volume (0.5 ml) of buffer 2 and mitochondrial protein content
was assaed by pyrogallol red method. All steps of mitochondrial isolation were performed
at 4oC.
4.1.3.4 Incubation of isolated mitochondria with antioxidants
Rat liver mitochondria (IRLM) isolated by the procedure described before, were incubated
with incubation medium (70 mM sucrose, 250 mM manitol, 2.5 mM KH2PO4, 2.5 mM MgCl2,
0.5 mM EDTA, 2 mM Hepes and BSA 0,1%, pH 7), in the absence (control group) or in the
presence of the antioxidants: VC, RSV and LA.
The incubation periods were determined after testing different times (0 to 360 minutes)
and 30 and 60 minutes were selected. The maximum incubation time was established at 60
minutes because at higher incubation periods the electron transport chain (ETC) was
uncoupled. All measurements were performed in triplicate.
4.1.3.5 Chemiluminescent measurement of superoxide and hidroperoxide production
by IRLM
Superoxide production was quantified by measuring the lucigenine‐derived
chemiluminiscence by a Luminoskan Ascent (Thermo Electron Corporation) at room
temperature (RT). The reaction mixture contained 0.5 mg of mitochondrial protein, 250 μl
of chemiluminiscence buffer and an exogenous substrate (5 mM of succinate). The
lucigenin‐derived chemiluminiscence was initiated by adding a final concentration of 5 μM
Chapter 4 Results I Capítulo 4 Resultados I
259
lucigenin and was continuously monitored up to 60 minutes. Several investigations have
described that a lucigenin concentration lower than 50 μM do not stimulate the redox
cycling (Li et al 1999, Li, Zhu and Trush 1999), that is the reason for which a concentration
of 5 µM (ten times lower) has been used in this study (Li et al 1999).
For hydroperoxide production measurement, the luminol‐derived chemiluminiscence was
quantified by a Luminoskan Ascent (Thermo Electron Corporation) at RT. 0.1 mg of
mitochondrial protein was mixed with a buffer, succinate (5 mM) and horseradish
peroxidase (10 μg/ml). The reaction of chemiluminiscence was initiated by adding of 5μM
luminol and was continuously monitored for 60 minutes.
In order to discriminate a possible error caused by the potential reactivity of the buffers
with lucigenin and luminol, we determined a background by measuring the
chemiluminiscence produced in mixtures with no mitochondria. The values obtained were
subtracted to the values obtained when mitochondria were added to these mixtures.
4.1.3.6 Activity of Sod2 and Gpx in IRLM
Sod2 activity in IRLM was measured with a colorimetric activity kit (Superoxide Dismutase
Activity Kit. Cat. nº 900‐157, Assay Designs Inc, Michigan, USA). This colorimetric assay was
based in the following reactions: firstly, O2*‐ was generated from the conversion of xanthine
and oxygen to uric acid and hydrogen peroxide catalized by xanthine oxidase. The O2*‐ then
converts WST‐1 to WST‐1 formazan, a coloured product that absorbs light at 450 nm.
Finally, Sod reduces the O2*‐ concentration and thereby lowers the rate of WST‐1‐formazan
formation. Reduction in the appearance of WST‐1‐formazan is a measure of Sod activity
present in our mitochondria (Ukeda et al 1997). In other words, relative Sod activity of the
experimental sample is determined from percent inhibition of the rate of formation of
WST‐1 formazan.
Gpx activity in IRLM was measured using a colorimetric activity kit assay (Glutathione
Peroxidase Activity Kit. Cat nº 900‐158, Assay Inc, Michigan, USA). This method is based on
the reaction of reduced glutathione (GSH) with H2O2, which produces oxidized glutathione
(GSSG). This reaction is catalyzed by Gpx. GSH are regenerated by the reaction of GSSG with
NADPH which in turn leads to the production of NADP+. The oxidation of NADPH to NADP+
is accompanied by a decrease in absorbance at 340 nm (A340). The rate of decrease in the
A340 is directly proportional to the Glutathione Peroxidase activity in the mitochondria.
Capítulo 4 Resultados I Chapter 4 Results I
260
4.1.3.7 Oxygen Consumption
Mitochondrial oxygen consumption was polarographically measured with a Hansatech (UK)
Clark‐type oxygen electrode (Respire1), whose incubation chamber was thermostatically
set at 30ºC and magnetically stirred. Freshly IRLM (1 mg/ml) were incubated in a respiration
medium containing 75 Mm NaCl, 1 mM EGTA, 10 mM NaTES, 2 mM NaH2PO4 and 1mg/ml
BSA FFA (Gonzalez‐Muniesa et al 2006). Succinate (2.5 mM) was added in order to mimic
the formation of intermediates of the citric acid cycle as occurs in vivo. Addition of ADP (0.1
mM) initiates state 3 respiration whereas state 4 is established when ADP is
phosphorylated and converted into ATP. Finally, maximal oxygen flux (state uncoupled) was
obtained by titration of the chemical uncoupler FCCP.
The mitochondrial function and coupling of the ETC was evaluated by the respiratory
control ratio (RCR) calculated according to Estabrook (Estabrook 1967). The P/O ratio was
also determined. This ratio has been defined as the amount of oxygen consumed during the
respiratory state 3, which it is the amount of oxygen used to drive ATP synthesis and proton
leakage across the mitochondrial membrane. In this context, the P/O ratio represents an
indirect measure of the efficiency of mitochondrial oxidative phosphorylation (OXPHOS)
(Hinkle 2005, Roussel et al 2004).
4.1.3.8 Statistical analysis
Data are reported as mean ± S.E. Normal distribution was confirmed by two different
methods, Shapiro‐Wilk and Kolmogorov‐Smirnov. In order to determine the effects of
different treatments, repeated measures Anova followed by post‐hoc comparisons by
Dunnet´s test were carried out. The interactions between incubation periods and
treatments were analyzed by two ways ANOVA. Relationships between variables were
analyzed by calculating Pearson correlation coefficients. All statistical analysis was
performed using GraphPad Prism 5.0 software. Differences were considered as statistically
significant at P<0.05.
Chapter 4 Results I Capítulo 4 Resultados I
261
4.1.4 RESULTS
4.1.4.1 Effects of Vitamin C, Resveratrol and Lipoic Acid on ROS production in IRLM
All the antioxidants tested (VC, RSV and LA) significantly decreased superoxide (O2*‐)
production as observed in Fig.1 (P<0.05‐P<0.0001) after both 30 and 60 minutes of
incubation. However, the magnitude of these inhibitory effects was different. Thus, the
decrease induced by VC was more potent than those observed after treatment with RSV or
LA.
Interestingly, hydroperoxide (H2O2) production was affected in a different way depending
on the antioxidant analyzed (Fig. 2). Thus, our data showed that VC and RSV induced a
significant inhibition (P<0.05‐P<0.0001) in the production of this reactive specie at both
incubation periods. However, treatment with LA showed a tendency to increase H2O2
generation after both incubation periods, although this increase did not reach statistical
significance.
Figure 1 Effects of different antioxidants on mitochondrial superoxide production in isolated rat liver
mitochondria after 30 and 60 minutes of incubation. Values shown are mean ± SE of integrated areas
under curve of lucigenin‐derived chemiluminiscence per mg of protein (n=7). *P<0.05; **P<0.01;
***P<0.0001 vs control group at each time according to repeated measure Anova with Dunnet´s post‐
hoc analysis.
Capítulo 4 Resultados I Chapter 4 Results I
262
Figure 2 Effects of different antioxidants on mitochondrial hydroperoxide production in isolated rat
liver mitochondria after 30 and 60 minutes of incubation. Values shown are mean ± SE of integrated
areas under curves of luminol‐derived chemiluminiscence per mg of protein (n=7). *P<0.05; **P<0.01;
***P<0.0001 vs control group at each time according to repeated measure Anova with Dunnet´s post‐
hoc analysis.
4.1.4.2 Effects of Vitamin C, Resveratrol and Lipoic Acid on mitochondrial antioxidant
enzymes
VC strongly stimulated Sod2 activity after all periods of incubation tested, being the highest
stimulatory effect after 30 minutos of treatment (197.60±35.99%; P<0.0001). RSV
significantly increased the activity of Sod2 after 30 and 60 minutes of treatment
(160±11.78%, P<0.0001 and 47.15±15.33%, P<0.01 respectively) and a significant
interaction between incubation time and treatment was observed (P<0.0001). In contrast,
LA treatment did not affect the activity of this antioxidant enzyme (Fig. 3A).
Chapter 4 Results I Capítulo 4 Resultados I
263
Figure 3 Influence of VC, RSV and LA on the activity of the main mitochondrial antioxidant enzymes:
Sod2 (A) and Gpx (B) in isolated rat liver mitochondria (n=7) after 30 and 60 minutos of incubation.
Values shown are mean ± SE. *P<0.05; **P<0.01; ***P<0.0001 vs control group at each time according
to repeated measure Anova with Dunnet´s post‐hoc analysis
.
Regarding the effects of these antioxidant on Gpx activity, VC treatment induced an
increase after 30 minutes (26.18±17.72%) and 60 minutes of treatment (15.70±5.76%) but
statistical differences were only observed after 60 minutes of incubation (P<0.05).
Moreover a positive correlation between H2O2 production and the activity of this enzyme
was observed (P=0.0008, r=0.8313). On the other hand, the effects of RSV on Gpx activity
were affected by the incubation time. In fact, RSV induced a significant decrease in Gpx
activity after 30 minutes of incubation (19.80±7.60%; P<0.01), although these effects
Capítulo 4 Resultados I Chapter 4 Results I
264
disappeared after 60 minutes. Finally, the treatment with LA has an inhibitory effect on the
activity of this enzyme after short incubation periods in comparison to the control
(16.48±3.27%, P<0.05) (Fig. 3B).
4.1.4.3 Effects of Vitamin C, Resveratrol and Lipoic Acid on respiratory parameters
The direct effects of these antioxidants on different parameters of mitochondrial electron
transport chain and OXPHOS were also investigated. Thus, the treatment with VC showed a
tendency to induce an increase the RCR after 60 minutes (Table 1). This increase seems to
be a consequence, at least in part, to the significant reduction observed in oxygen
consumption on respiratory state 4 (P<0.05) (Table 1).
Chapter 4 Results I Capítulo 4 Resultados I
265
Table 1 Changes on respiratory parameters after incubation of IRLM with VC, RSV and LA.
Incubation
time (min)
Control VC
30 µM
RSV
50 µM
LA
30 µM
ANOVA
30 min RCR 3.63±0.35 3.29±0.71 3.26±0.64 2.71±0.76 0.0048
n.s n.s **
State 2 28.17±4.40 23.59±9.22 23.03±8.87 29.78±10.4 0.0323
nmolO2/min/mg n.s n.s n.s
State 3 81.34±7.97 75.06±18.7 73.73±9.79 72.66±9.50 0.2787
nmolO2/min/mg n.s n.s n.s
State 4 31.37±6.24 25.02±10.6 23.88±6.55 28.89±11.1 0.0117
nmolO2/min/mg * * n.s
60 min RCR 3.11±0.39 3.41±0.33 3.16±0.38 2.16±0.64 0,0003
n.s n.s **
State 2 19.93±8.20 20.12±3.37 21.51±4.12 20.48±4.46 0.9354
nmolO2/min/mg n.s n.s n.s
State 3 71.23±7.92 70.63±10.2 69.76±8.30 55.31±4.57 0.0071
nmolO2/min/mg n.s n.s **
State 4 27.36±3.85 23.32±3.98 24.08±4.38 23.74±3.88 0.0501
nmolO2/min/mg * n.s n.s
Values shown are mean ± SE (n=6). *P<0.05; **P<0.01 vs control group at each time, according
to repeated measure Anova with Dunnet´s post‐hoc analysis. Respiratory state 2 was
established in presence of oxidazable substrates (succinate 2.5 mM plus rotenone 5µg/µl).
Respiratory state 3 was measure in presence of ADP 0.1 mM. Respiratory state 4 was
established after ADP was phosphorylated on ATP.
Capítulo 4 Resultados I Chapter 4 Results I
266
In addition, the P/O ratio was significantly reduced by VC after 30 and 60 minutes of
incubation (P<0.05) (Fig. 4A). A significant reduction in respiratory state 4 after 30 minutes
of incubation was also observed after RSV treatment (P<0.05) as well as a significant
decrease in the P/O ratio, but only at longer incubation periods (P<0.05) (Fig. 4B). Finally,
treatment of IRLM with LA induced the strongest effects on respiratory parameters in
comparison with the other two antioxidants analyzed. Thus, LA induced a significant
decreased in RCR after 30 and 60 minutes (P<0.01), which seems to be secondary to the
decrease observed on oxygen consumption in respiratory state 3 (Table 1). Furthermore, a
significant reduction in the P/O ratio was also found after treatment with this antioxidant
(P<0.05‐P<0.0001) (Fig. 4C).
Figure 4 Changes in P/O ratio after treatment with Vitamin C (A), Resveratrol (B) and Lipoic acid (LA)
at different incubation periods (n=6). Values shown are mean ± SE (n=6). *P<0.05; **P<0.01;
***P<0.0001 vs control group at each time according to repeated measure Anova with Dunnet´s post‐
hoc analysis.
Chapter 4.1 Results I Capítulo 4.1 Resultados I
267
4.1.5 DISCUSSION
Antioxidants are defined as “any substance that when present at low concentrations
compared with those of an oxidizable substrate significantly delays or prevents oxidation of
that substrate” (Halliwell 1999). However, herein we have demonstrated for the first time
that not all antioxidants behave on the same way or with the same intensity, at least when
their direct actions on mitochondria are analyzed.
Vitamin C is one of the most widely used dietary supplementation due to its antioxidant
properties. The ability of VC to reduce and neutralize ROS has been widely described
(Wilson 2009). Our data showed that treatment of IRLM with VC (30 µM) induced a
significant decrease in the levels of O2*–, which was corroborated by Oliveira et al (2003)
(Oliveira et al 2003). These beneficial effects could be explained by the stimulation exerted
by this vitamin on Sod2 activity, suggesting that O2*– is rapidly converted into H2O2. In this
sense, previous studies have shown that the protective role of VC against oxidative stress is
mediated by the stimulation of major mitochondrial antioxidant enzymes (Lowes, Webster
and Galley, Devi et al 2007).
The beneficial effects of VC on oxidative damage can also be justified by its capacity to
modulate the H2O2 production, as demonstrated in several studies (Ahn, Yun and Oh 2006)
as in ours. H2O2 generation has been associated with oxygen consumption in respiratory
state 4 (Boveris and Chance 1973). In this sense, we observed a significant reduction in
H2O2 production and in oxygen consumption in state 4, suggesting that the decrease
detected in H2O2 after treatment with VC may be secondary to the reduction in oxygen
consumption in this respiratory state. Another mechanism that could explain the reduction
found in H2O2 generation after VC treatment is the increased activity of Gpx, which catalyze
the detoxification of H2O2 to H2O.
We have also investigated the effects of VC on the functionality and efficiency of the ETC.
Our data showed an increase in the RCR after 60 minutes of treatment with VC, which could
be due, at least in part, to the reduction observed in oxygen consumption in state 4.
Moreover, VC induced a significant decrease in the P/O ratio, which has been established as
a marker of the OXPHOS efficiency (Hinkle 2005). These results might suggest that VC may
have a potential positive role in the treatment of obesity by decreasing metabolic
Capítulo 4.1 Resultados I Chapter 4.1 Results I
268
efficiency. Indeed, recent investigations showed a decrease in metabolic efficiency in an
animal model of DIO supplemented with this vitamin (Campion et al 2008).
This data evidenced, that VC exerts these positive effects on mitochondrial redox state by
inducing the activity of the electron transport chain, which is supported by the increase
observed in the RCR, as found by Mandl et al (2009) (Mandl, Szarka and Banhegyi 2009).
This increase in the ETC activity gives support to findings concerning to the decrease in O2*–
levels observed in isolated mitochondria treated with VC. Furthermore, this increase in ETC
activity provides electrons to ascorbic acid in order to be transformed into dihydroascorbic
acic, as previously proposed by Madl et al (2009). In addition, several studies have reported
that VC is a natural scavenger of ROS (Arrigoni and De Tullio 2002), being able to increase
the Sod2 and Gpx expression and activity (Devi et al 2007, Yogeeta et al 2006), which, in
turn, leads to a decrease in superoxide and hydrogen peroxide production, respectively.
RSV has been reported to improve the mitochondrial function (Brookins Danz et al 2009,
Lagouge et al 2006). The capacity of this antioxidant to reduce ROS levels has been
proposed as a mechanism that could explain its protective role against situations with an
imbalance in the oxidative status (Lu et al 2008). In this sense, a reduction on O2*–
generation was observed in our study. This reduction seems to be secondary to the
increase observed in Sod2 activity, as previously reported with VC. Furthermore, different
studies have proposed that the beneficial effects of RSV against oxidative stress damage are
mediated by a specific and progressive stimulation of Sod2 (Robb et al 2008b).
Furthermore, RSV showed a very potent inhibitory action on H2O2 production. Our findings
were corroborate by Brookins Danz et al (2009) (Brookins Danz et al 2009), who observed a
decrease in basal production of H2O2 after treatment with RSV in neonatal rat ventricular
myocytes. This decrease could be explained by the reduction on respiratory state 4, in fact,
and similarly as VC, a significant decrease in H2O2 generation and in state 4 were observed.
Conversely, changes in H2O2 production could not be explained by variations in Gpx activity
in our study. In fact, our results showed a decrease in the activity of this enzyme after 30
minutos of exposure to the antioxidant; however, this effect disappeared in longer
incubation periods. Previous studies showed conflicting results regarding the action of RSV
on the activity of Gpx, suggesting that its effects depends on the tissue, dose and period of
treatment (Bujanda et al 2008, Robb et al 2008a).
Chapter 4.1 Results I Capítulo 4.1 Resultados I
269
Concerning the actions of RSV on the functionality and efficiency of the ETC, this
polyphenol did not show any effects in RCR, although a significant decrease in a P/O ratio
was found. Thus, our results suggest that main effects of RSV in IRLM are the direct and
progressive activation of Sod2 which is supported by data from Robb et al (2008) (Robb et
al 2008b, Robb et al 2008a). In addition, several investigations have proven the potent
effect of RSV to scavenger ROS, which corroborates the decreased production of both
superoxide and hydrogen peroxide species observed in our study.
LA has been defined as the "antioxidant of antioxidants" (Packer, Witt and Tritschler 1995)
because of its ability to decrease ROS production (Shen et al 2008) and to stimulate the
activity of antioxidant enzymes (Long et al 2009). Thus, investigations carried out in
mitochondria isolated from rat cardiomyocytes found a decline in the levels of O2●– after
treatment with different doses of DHLA, which is the reduced form of LA (Schonheit, Gille
and Nohl 1995). Accordingly, our data showed a decrease in the levels of O2●– after
treatment with LA, although this decrease cannot be explained by variations in Sod2
activity. On the other hand, these results could be explained by different mechanisms
associated with REDOX reactions that maintain the balance between the LA and DHLA
(Haramaki et al 1997). In fact, some research described the capacity of DHLA to neutralized
O2●–, therefore our investigation could suggest that the decrease observed in O2
●– could be
due, at least in part, by the transformation of LA into DHLA.
Despite these findings, it has also been established that LA may have pro‐oxidant effects
depending on its concentration, incubation time and the experimental model used
(Cakatay 2006). In fact, our results showed a stimulatory action of LA on H2O2 generation, at
all incubation periods tested, similarly to the data provided by Dicter et al (2002) (Dicter,
Madar and Tirosh 2002). The increased levels of H2O2 could be explained by the reduction
observed in the activity of Gpx, which, in turn, could be due to a displacement of the
GSH:GSSG balance to the oxidized form, as described by Morkunaite et al (2000)
(Morkunaite, Teplova and Saris 2000). However, we have not addressed this hypothesis.
Regarding the effects of LA on the ETC, our data revealed a significant decrease in RCR,
suggesting that this acid could uncouple the ETC. In fact, similar data were observed by
Schönheit et al (1995) (Schonheit, Gille and Nohl 1995). We consider that the uncoupling
effect of lipoic acid in electron transport chain is the strongest effect of this molecule in
Capítulo 4.1 Resultados I Chapter 4.1 Results I
270
IRLM. The data are consequently in agreement with other researches that have described
this effect of LA (Dicter, Madar and Tirosh 2002). Our data also showed a decrease in the
ratio P/O after treatment with LA corroborating previous studies (Schonheit, Gille and Nohl
1995). These findings could suggest a potential therapeutic role of LA in the treatment of
obesity. However, these results should be interpreted with caution since LA might have
pro‐oxidant and antioxidant properties in different circumstances.
In summary, VC improved mitochondrial function by decreasing ROS levels and by
increasing the activity of antioxidant enzymes and the activity of the ETC. The magnitude of
the beneficial effects of RSV was lower than those observed for VC, probably because other
factors such as sirtuins could also be involved. By contrast, treatment with LA induced an
apparently pro‐oxidant effect on IRLM. The main mechanisms involved in this pro‐oxidant
effect could be summarized as the induction of an uncoupling the ETC and the stimulation
observed in H2O2 generation, which seems to be due to the inhibition of Gpx activity.
Finally, this study demonstrated that VC, RSV and LA exerted direct effects on
mitochondrial function, although the magnitude and intensity of these effects were
significantly different. Furthermore, LA appears to exert some pro‐oxidant actions,
suggesting that not all antioxidants are equal or their effects are mediated by the same
pathways. In fact, the outcomes after incubation of mitochondria with the three
antioxidants should be carefully examined since the physical properties of the assayed
molecules are different and could affect their ability to enter the mitochondria and
therefore to affect their functionality. However, it is important to state that LA showed
quite different actions in comparison with VC and RSV even though both LA and RSV are
lipophylic molecules, suggesting that other mechanisms different from pure physical
characteristics of the compounds are involved in their effects on mitochondria. In fact, this
is not the first time that compounds with similar chemical function demonstrate differential
actions. Thus, Perez‐Matute et al (2007) demonstrated different actions on basal leptin
production between linoleic acid and its isomer conjugated linoleic acid (Perez‐Matute et
al 2007). Taking into account these findings, more in vivo studies are needed in order to
Chapter 4.1 Results I Capítulo 4.1 Resultados I
271
elucidate the beneficial effects of VC, RSV and LA on mitochondrial function and oxidative
stress associated diseases such as obesity.
ACKNOWLEDGEMENTS
The authors thank Dr. Eduardo Rial and Dra. MJ López‐Zabalza their very helpful scientific
support. We would like to acknowledge Ana Lorente for her technical assistance. This work
has been supported by Línea especial “Nutrición, Obesidad y Salud” (University of Navarra
LE/97). MP. Valdecantos has been granted a scholarship from “Instituto de Salud Carlos III”
(ISCIII) (Spanish Ministry of Health).
Capítulo 4.1 Resultados I Chapter 4.1 Results I
272
4.1.6 REFERENCES
Ahn T, Yun CH and Oh DB. (2006). Tissue‐specific effect of ascorbic acid supplementation on
the expression of cytochrome P450 2E1 and oxidative stress in streptozotocin‐induced
diabetic rats. Toxicol Lett. 166, 27‐36.
Arrigoni O and De Tullio MC. (2002). Ascorbic acid: much more than just an antioxidant.
Biochim Biophys Acta. 1569, 1‐9.
Baur JA, Pearson KJ, Price NL, Jamieson HA, Lerin C, Kalra A, Prabhu VV, Allard JS, Lopez‐
Lluch G, Lewis K, Pistell PJ, Poosala S, Becker KG, Boss O, Gwinn D, Wang M, Ramaswamy
S, Fishbein KW, Spencer RG, Lakatta EG, Le Couteur D, Shaw RJ, Navas P, Puigserver P,
Ingram DK, de Cabo R and Sinclair DA. (2006). Resveratrol improves health and survival
of mice on a high‐calorie diet. Nature. 444, 337‐42.
Boveris A and Chance B. (1973). The mitochondrial generation of hydrogen peroxide.
General properties and effect of hyperbaric oxygen. Biochem J. 134, 707‐16.
Brookins Danz ED, Skramsted J, Henry N, Bennett JA and Keller RS. (2009). Resveratrol
prevents doxorubicin cardiotoxicity through mitochondrial stabilization and the Sirt1
pathway. Free Radic Biol Med.
Bujanda L, Hijona E, Larzabal M, Beraza M, Aldazabal P, Garcia‐Urkia N, Sarasqueta C,
Cosme A, Irastorza B, Gonzalez A and Arenas JI, Jr. (2008). Resveratrol inhibits
nonalcoholic fatty liver disease in rats. BMC Gastroenterol. 8, 40.
Cakatay U. (2006). Pro‐oxidant actions of alpha‐lipoic acid and dihydrolipoic acid. Med
Hypotheses. 66, 110‐7.
Campion J, Milagro FI, Fernandez D and Martinez JA. (2008). Vitamin C supplementation
influences body fat mass and steroidogenesis‐related genes when fed a high‐fat diet. Int
J Vitam Nutr Res. 78, 87‐95.
Devi SA, Vani R, Subramanyam MV, Reddy SS and Jeevaratnam K. (2007). Intermittent
hypobaric hypoxia‐induced oxidative stress in rat erythrocytes: protective effects of
vitamin E, vitamin C, and carnitine. Cell Biochem Funct. 25, 221‐31.
Dicter N, Madar Z and Tirosh O. (2002). Alpha‐lipoic acid inhibits glycogen synthesis in rat
soleus muscle via its oxidative activity and the uncoupling of mitochondria. J Nutr. 132,
3001‐6.
Estabrook R. (1967). Mitochondrial respiratory control and the polargraphic measurement
of P/O ratios. Methods in enzimology. 10, 41‐47.
Chapter 4.1 Results I Capítulo 4.1 Resultados I
273
Flora SJ. (2007). Role of free radicals and antioxidants in health and disease. Cell Mol Biol
(Noisy‐le‐grand). 53, 1‐2.
Garcia‐Diaz D, Campion J, Milagro FI and Martinez JA. (2007). Adiposity dependent apelin
gene expression: relationships with oxidative and inflammation markers. Mol Cell
Biochem. 305, 87‐94.
Gonzalez‐Muniesa P, Milagro FI, Campion J and Martinez JA. (2006). Reduction in energy
efficiency induced by expression of the uncoupling protein, UCP1, in mouse liver
mitochondria. Int J Mol Med. 17, 591‐7.
Halliwell B. (1999). Free radical in biology and medicine. New York.
Haramaki N, Han D, Handelman GJ, Tritschler HJ and Packer L. (1997). Cytosolic and
mitochondrial systems for NADH‐ and NADPH‐dependent reduction of alpha‐lipoic acid.
Free Radic Biol Med. 22, 535‐42.
Hinkle PC. (2005). P/O ratios of mitochondrial oxidative phosphorylation. Biochim Biophys
Acta. 1706, 1‐11.
Lagouge M, Argmann C, Gerhart‐Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N, Milne
J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P and Auwerx J. (2006). Resveratrol
improves mitochondrial function and protects against metabolic disease by activating
Sirt1 and PGC‐1alpha. Cell. 127, 1109‐22.
Lee BW, Kwon SJ, Chae HY, Kang JG, Kim CS, Lee SJ, Yoo HJ, Kim JH, Park KS and Ihm SH.
(2009). Dose‐related cytoprotective effect of alpha‐lipoic acid on hydrogen peroxide‐
induced oxidative stress to pancreatic beta cells. Free Radic Res. 43, 68‐77.
Li Y, Stansbury KH, Zhu H and Trush MA. (1999). Biochemical characterization of lucigenin
(Bis‐N‐methylacridinium) as a chemiluminescent probe for detecting intramitochondrial
superoxide anion radical production. Biochem Biophys Res Commun. 262, 80‐7.
Li Y, Zhu H and Trush MA. (1999). Detection of mitochondria‐derived reactive oxygen
species production by the chemilumigenic probes lucigenin and luminol. Biochim
Biophys Acta. 1428, 1‐12.
Long J, Gao F, Tong L, Cotman CW, Ames BN and Liu J. (2009). Mitochondrial decay in the
brains of old rats: ameliorating effect of alpha‐lipoic acid and acetyl‐L‐carnitine.
Neurochem Res. 34, 755‐63.
Lowes DA, Webster NR and Galley HF. Dehydroascorbic acid as pre‐conditioner: protection
from lipopolysaccharide induced mitochondrial damage. Free Radic Res. 44, 283‐92.
Capítulo 4.1 Resultados I Chapter 4.1 Results I
274
Lu C, Bambang IF, Armstrong JS and Whiteman M. (2008). Resveratrol blocks high glucose‐
induced mitochondrial reactive oxygen species production in bovine aortic endothelial
cells: role of phase 2 enzyme induction? Diabetes Obes Metab. 10, 347‐9.
Mandl J, Szarka A and Banhegyi G. (2009). Vitamin C: update on physiology and
pharmacology. Br J Pharmacol. 157, 1097‐110.
Morkunaite‐Haimi S, Kruglov AG, Teplova VV, Stolze K, Gille L, Nohl H and Saris NE. (2003).
Reactive oxygen species are involved in the stimulation of the mitochondrial
permeability transition by dihydrolipoate. Biochem Pharmacol. 65, 43‐9.
Morkunaite S, Teplova VV and Saris NE. (2000). Mechanism of dihydrolipoate stimulation of
the mitochondrial permeability transition: effect of different respiratory substrates.
IUBMB Life. 49, 211‐6.
Oliveira CP, Gayotto LC, Tatai C, Della Nina BI, Lima ES, Abdalla DS, Lopasso FP, Laurindo FR
and Carrilho FJ. (2003). Vitamin C and vitamin E in prevention of Nonalcoholic Fatty Liver
Disease (NAFLD) in choline deficient diet fed rats. Nutr J. 2, 9.
Packer L, Witt EH and Tritschler HJ. (1995). alpha‐Lipoic acid as a biological antioxidant. Free
Radic Biol Med. 19, 227‐50.
Perez‐Matute P, Marti A, Martinez JA, Fernandez‐Otero MP, Stanhope KL, Havel PJ and
Moreno‐Aliaga MJ. (2007). Conjugated linoleic acid inhibits glucose metabolism, leptin
and adiponectin secretion in primary cultured rat adipocytes. Mol Cell Endocrinol. 268,
50‐8.
Prieto‐Hontoria PL, Pérez‐Matute P., Fernández‐Galilea M., Martínez J.A., Moreno‐Aliaga
M.J.. (2009). Lipoic acid prevents body weight gain induced by a high fat diet in rats:
Effects on intestinal sugar transport. Journal of Physiology and Biochemestry. 65, 43‐50.
Qu B, Li QT, Wong KP, Tan TM and Halliwell B. (2001). Mechanism of clofibrate
hepatotoxicity: mitochondrial damage and oxidative stress in hepatocytes. Free Radic
Biol Med. 31, 659‐69.
Rahangdale S, Yeh SY, Malhotra A and Veves A. (2009). Therapeutic interventions and
oxidative stress in diabetes. Front Biosci. 14, 192‐209.
Ratnam DV, Ankola DD, Bhardwaj V, Sahana DK and Kumar MN. (2006). Role of antioxidants
in prophylaxis and therapy: A pharmaceutical perspective. J Control Release. 113, 189‐
207.
Rickwood D, Darley‐Usmar VM and Wilson MT 1987. Mitochondria a practical approach. In:
DARLEY‐USMAR, VM, RICKWOOD, D & WILSON, MT (eds.). IRL Press Oxford.
Chapter 4.1 Results I Capítulo 4.1 Resultados I
275
Robb EL, Page MM, Wiens BE and Stuart JA. (2008a). Molecular mechanisms of oxidative
stress resistance induced by resveratrol: Specific and progressive induction of Sod2.
Biochem Biophys Res Commun. 367, 406‐12.
Robb EL, Winkelmolen L, Visanji N, Brotchie J and Stuart JA. (2008b). Dietary resveratrol
administration increases Sod2 expression and activity in mouse brain. Biochem Biophys
Res Commun. 372, 254‐9.
Roberts CK and Sindhu KK. (2009). Oxidative stress and metabolic syndrome. Life Sci.
Roussel D, Dumas JF, Simard G, Malthiery Y and Ritz P. (2004). Kinetics and control of
oxidative phosphorylation in rat liver mitochondria after dexamethasone treatment.
Biochem J. 382, 491‐9.
Rubiolo JA, Mithieux G and Vega FV. (2008). Resveratrol protects primary rat hepatocytes
against oxidative stress damage: activation of the Nrf2 transcription factor and
augmented activities of antioxidant enzymes. Eur J Pharmacol. 591, 66‐72.
Rubiolo JA and Vega FV. (2008). Resveratrol protects primary rat hepatocytes against
necrosis induced by reactive oxygen species. Biomed Pharmacother. 62, 606‐12.
Sagun KC, Carcamo JM and Golde DW. (2005). Vitamin C enters mitochondria via facilitative
glucose transporter 1 (Glut1) and confers mitochondrial protection against oxidative
injury. Faseb J. 19, 1657‐67.
Schonheit K, Gille L and Nohl H. (1995). Effect of alpha‐lipoic acid and dihydrolipoic acid on
ischemia/reperfusion injury of the heart and heart mitochondria. Biochim Biophys Acta.
1271, 335‐42.
Shen W, Liu K, Tian C, Yang L, Li X, Ren J, Packer L, Head E, Sharman E and Liu J. (2008).
Protective effects of R‐alpha‐lipoic acid and acetyl‐L‐carnitine in MIN6 and isolated rat
islet cells chronically exposed to oleic acid. J Cell Biochem. 104, 1232‐43.
Smith AR, Shenvi SV, Widlansky M, Suh JH and Hagen TM. (2004). Lipoic acid as a potential
therapy for chronic diseases associated with oxidative stress. Curr Med Chem. 11, 1135‐
46.
Ukeda H, Maeda S, Ishii T and Sawamura M. (1997). Spectrophotometric assay for
superoxide dismutase based on tetrazolium salt 3'‐‐1‐‐ (phenylamino)‐carbonyl‐‐3, 4‐
tetrazolium]‐bis (4‐methoxy‐6‐nitro)benzenesulfonic acid hydrate reduction by
xanthine‐xanthine oxidase. Anal Biochem. 251, 206‐9.
Valdecantos MP, Perez‐Matute P and Martinez JA. (2009). [Obesity and oxidative stress:
role of antioxidant supplementation]. Rev Invest Clin. 61, 127‐39.
Capítulo 4.1 Resultados I Chapter 4.1 Results I
276
Vincent HK, Bourguignon CM, Vincent KR, Weltman AL, Bryant M and Taylor AG. (2006).
Antioxidant supplementation lowers exercise‐induced oxidative stress in young
overweight adults. Obesity (Silver Spring). 14, 2224‐35.
Wilson JX. (2009). Mechanism of action of vitamin C in sepsis: ascorbate modulates redox
signaling in endothelium. Biofactors. 35, 5‐13.
Yogeeta SK, Raghavendran HR, Gnanapragasam A, Subhashini R and Devaki T. (2006).
Ferulic acid with ascorbic acid synergistically extenuates the mitochondrial dysfunction
during beta‐adrenergic catecholamine induced cardiotoxicity in rats. Chem Biol Interact.
163, 160‐9.
Yu BP. (1994). Cellular defenses against damage from reactive oxygen species. Physiol Rev.
74, 139‐62.
Zhang S, Fu J and Zhou Z. (2004). In vitro effect of manganese chloride exposure on reactive
oxygen species generation and respiratory chain complexes activities of mitochondria
isolated from rat brain. Toxicol In Vitro. 18, 71‐7.
CAPÍTULO 4.2 /CHAPTER 4.2
Erythrocyte antioxidant defenses as a potential
biomarker of liver mitochondrial status in different
oxidative conditions
Published in Biomarkers Dec;16(8):670‐8
Chapter 4.2 Results II Capítulo 4.2 Resultados II
279
4.2 ERYTHROCYTE AS A POTENTIAL BIOMARKER OF LIVER MITOCHONDRIAL
ANTIOXIDANT STATUS
Capítulo 4.2 Resultados II Chapter 4.2 Results II
280
4.2.1 ABSTRACT
The need for minimally invasive biomarkers to predict the progression of non‐alcoholic
fatty‐liver disease to non‐alcoholic steatohepatitis is a priority. Oxidative stress and
mitochondrial dysfunction contribute in this physiopathological process. The aim of this
study was to analyze the potential role of erythrocytes as surrogate biomarkers of hepatic
mitochondrial oxidative status in an animal model under different dietary oxidative
conditions. Interestingly, we found that erythrocyte antioxidant status correlated with
triglyceride content (P<0.05‐P<0.001), TBARS levels (P<0.001) and with liver mitochondrial
antioxidant levels (P<0.001). These data suggest that erythrocyte antioxidant defenses
could be used as sensitive and minimally invasive biomarkers of mitochondrial status in
diverse oxidative conditions.
Keywords: high fat diet; obesity; NASH; oxidative stress; steatosis
Abbreviations: NASH, non‐alcoholic steatohepatitis; NAFLD, non‐alcoholic fatty liver
disease; Sod2, manganese superoxide dismutase; mtGpx, mitochondrial glutathione
peroxidase; SOD, superoxide dismutase; Gpx, glutathione peroxidase; HFD, high‐fat diet;
LA, α‐lipoic acid; TG, triglyceride; TBARS; thiobarbituric acid reactive species; MDA,
malondialdehyde; mtDNA, mitochondrial DNA; GSH, reduced glutathione; GSSG, oxidized
glutathione; WAT, visceral white adipose tissue.
Chapter 4.2 Results II Capítulo 4.2 Resultados II
281
RESUMEN
Es prioritario encontrar biomarcadores mínimamente invasivos para predecir la progresión
de la enfermedad hepática no alcohólica a esteatohepatitis. El estrés oxidativo y la
disfunción mitocondrial contribuyen a este proceso fisiopatológico. El objetivo de este
estudio es valorar el papel potencial de las defensas antioxidantes eritrocitarias como
biomarcadores del estado oxidativo del compartimento hepático mitocondrial en un
modelo animal alimentado con dietas que promueven diferentes estados antioxidantes.
Por otro lado, observamos que las defensas antioxidantes eritrocitarias estaban
estrechamente correlacionadas con el contenido hepático de triglicéridos (P<0.05‐P<0.001),
los niveles de TBARS (P<0.001), así como con las defensas antioxidantes en el
compartimento hepático mitocondrial (P<0.001). Estos datos sugieren que las defensas
antioxidantes eritrocitarias podrían emplearse como biomarcadores sensibles y
mínimamente invasivos del estado antioxidante mitocondrial en el hígado bajo diferentes
situaciones del balance antioxidante/pro‐oxidante.
Capítulo 4.2 Resultados II Chapter 4.2 Results II
282
4.2.2 INTRODUCTION
Currently, the diagnosis of non alcoholic steatohepatitis (NASH) requires liver biopsy with
corresponding drawbacks of sampling and interpretation errors (Adams and Feldstein
2011). Hence, the need for minimally invasive methods to cover the whole spectrum of non
alcoholic fatty liver disease (NAFLD) is a priority. In fact, several investigations have focused
on diagnostic methods such as breath markers (Millonig et al 2010, Solga et al 2006), but
the results are inconclusive and further studies are needed. It is also necessary for future
research to develop less invasive biomarkers to identify patients at risk of liver disease
progression.
NAFLD is generally considered as one of the main causes of hepatic dysfunction linked to
obesity and an important manifestation of metabolic syndrome (Rector et al 2010, Cohen,
Horton and Hobbs 2011). In obese individuals, the increased supply of free fatty acids from
diet, from adipose tissue and through increased “de novo” lipogenesis all serve to promote
hepatic steatosis (Donnelly et al 2005). Moreover, visceral adipose tissue seems to play a
major role by secreting hormones and adypokines that contribure to the progression of
NAFLD to NASH (Wree et al 2011).
The role of oxidative stress as a key contributor to the transition from non‐alcoholic fatty
liver disease, usually asymptomatic, to non‐alcoholic steatohepatitis has been widely
accepted (Pessayre 2007). On the other hand, another major factor involved in the
pathophysiological evolution of NAFLD to NASH is the impairment in mitochondrial
function, which is linked with an increase of oxidative stress. (Perez‐Carreras et al 2003,
Rector et al 2010). In this sense, the mitochondrion is a major cellular site involved in
energy metabolism (Brand 2010), but it is also the main source of reactive oxygen species
(ROS). Furthermore, and in order to counterbalance the negative effects of ROS,
mitochondria also contain enzymatic antioxidant defenses, such as manganese superoxide
dismutase (Sod2) (Brunet et al 2004), mitochondrial glutathione peroxidase (mtGpx)
(Lowes and Galley 2011) and mitochondrial glutathione (Canto et al 2009). When the
balance between mitochondrial ROS generation and the antioxidants occurs, an increase in
mitochondrial oxidative stress is observed, which leads to impaired mitochondrial function
(Ozden et al 2011, Simula and De Re 2010).
Chapter 4.2 Results II Capítulo 4.2 Resultados II
283
Erythrocyte antioxidant status has been described as a biomarker of general oxidative
stress (Kalahasthi, Hirehal Raghavendra Rao and Bagalur Krishna Murthy 2006, Pavao et al
2006). In fact, several studies have used antioxidant defenses for example, superoxide
dismutase (SOD) and glutathione peroxidase (Gpx) activities as predictors in the
development of oxidative stress linked to disorders such as cancer (Monari et al 2006) or
neurodegenerative diseases (Torsdottir et al 2010). Thus, we investigated if erythrocytes
could also be potential biomarkers of antioxidant status using an animal model under
different oxidative conditions: obesity and obesity‐treated with alimentary antioxidant, α‐
lipoic acid (LA).
4.2.3 METHODS
4.2.3.1 Animals and diets
Male Wistar rats (n=40) aged six weeks were supplied from the Applied Pharmacology
Research Center (CIFA, Pamplona, Spain). Animals were housed in cages in a temperature‐
controlled room (22 ±2˚C) with a 12‐hour light‐dark cycle, fed a pelleted chow diet and
given deionised water ad libitum for an adaptation period of 5 days. After this period, rats
were assigned to four experimental groups for 8 weeks. Control (C) and CLIP (control + LA)
groups were fed a standard diet (Harlam Tekland Global Diets, USA) containing 4.6 % of
energy as a lipids per dry weight. The Obese (OB) and OLIP (obese + LA) were fed a high‐fat
diet (HFD) containing 60 % of energy as a lipids per dry weight. The diet of the CLIP and
OLIP subgroups was supplemented with α‐LA (Sigma Aldrich, USA) in a proportion of 0.25
g/100 g of diet as previously described (Prieto‐Hontoria 2009).
Body weight and food intake were recorded every 2‐3 days. At the end of the experimental
period, rats were euthanized by decapitation and blood and tissue samples were
immediately collected, frozen in liquid nitrogen and kept at ‐80 ˚C. Until analysis, all
experimental procedures were performed according to National and Institutional
Guidelines for Animal Care and Use at the University of Navarra.
4.2.3.2 Tissue homogenization procedure and mitochondrial isolation
Livers were quickly excised after sacrificing the animals and either frozen in liquid nitrogen
or placed in ice‐cold buffer (250 mM sucrose, 1 mM EDTA and 5 mM NaTES, pH=7.4). Fresh
tissue placed in buffer was used to prepare mitochondrial suspensions according to the
Capítulo 4.2 Resultados II Chapter 4.2 Results II
284
method of Rickwood et al (1987) (Rickwood, Darley‐Usmar and Wilson 1987) with slight
modifications as described elsewhere (Valdecantos et al 2010).
4.2.3.3 Erythrocyte concentrates
Erythrocyte concentrates were obtained after centrifugation in Vacutainer tubes containing
gel without additives (Vacutainer Gel SST II) and pellets were resuspended in PBS and kept
at ‐80 ºC.
4.2.3.4 Hepatic triglyceride content
To determine the hepatic triglyceride (TG) content, 150 mg of these tissues were sonicated
in a Branson 250 Sonifier (Duty cycle 40%; Output control 4; Hold Continuous) for 40
seconds in 1.5 ml of buffer (150 mM NaCl, 0,1% Triton and 10 mM Tris (pH8)) at 50ºC. After
centrifugation at 12000g for 10 min, the obtained supernatants were used to measure the
TG levels with a COBAS‐Mira analyzer (Roche Diagnostics, Switzerland) using an enzymatic
kit (Horiba ABX, USA) and a COBAS‐Mira analyzer (Roche Diagnostics, Switzerland) as
described elsewhere (Perez‐Echarri et al 2009).
4.2.3.5 Lipid peroxidation
The formation of thiobarbituric acid reactive species (TBARS) derived from the reaction
with reactive aldehydes, such as malonyldialdehyde (MDA), from the decomposition of the
unstable peroxides was spectrophotometricallyq uantified following their controlled
reaction with thiobarbituric acid. Changes in absorbance were measured in liver
homogenate with a commercial kit (Cayman Chemical, Michigan, USA) according to the
manufacturer’s instructions with slightly modifications and using a Luminoskan Ascent
spectrophotometer (Thermo Electron Corporation, USA). Results were corrected by the
amount of tissue in milligrams (mg).
4.2.3.6 Real‐time quantitative PCR
Total RNA was isolated from liver using Trizol® reagent (Invitrogen, Carlsbad, California,
USA) according to the manufacturer’s instructions. RNA concentrations were determined by
Nanodrop 1000 (Thermo Electron Corporation, Foster City, California, USA). To avoid
contamination with genomic DNA, DNA digestion and inactivation was assessed using the
Chapter 4.2 Results II Capítulo 4.2 Resultados II
285
DNAse kit (Ambion Inc, St. Austin, Texas, USA). Four micrograms of RNA were transcribed to
cDNA using the M‐MLV kit (Invitrogen) following instructions from the suppliers.
4.2.3.7 Mitochondrial oxidative damage estimation
Mitochondrial DNA (mtDNA) oxidative damage was estimated as the ratio of 80‐bp
fragment (260–339 position), compared to a 162‐bp fragment (260–421 position) of the
same sample. For real‐time PCR reactions of both fragments, we used SYBR Green qPCR
Master Mix with ROX as reference dye (Invitrogen, Carlsbad, California, USA) in an ABI
PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, California,
USA). The primers used were HVII‐FOR260 (5´‐GCCACTTTCCACACAGACATCATA‐3´), HVII‐
L421 (5´‐AGTGCATACCGCCAAAA GATAAA‐3´) and HVII‐C339 (5´‐
TGTTTAAGTGCTGTGGCCAGA‐3´) from Sigma Aldrich (Sigma Aldrich, St. Louis, Missouri,
USA). Both fragments were amplified in a total volume of 10 μl with 15 ng of total DNA, 5 μl
SYBR Green Mix and 10 μM of HVII‐FOR260 and HVII‐L421 for large fragments and 2.5 μM
HVII‐FOR260 and HVII‐C339 for short fragments. The PCR conditions were 2 min at 50°C,
95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min.
4.2.3.8 Measurement of antioxidant defences
Total Sod and Gpx activities were measured in erythrocyte concentrates. Manganese
superoxide dismutase and mitochondrial Gpx activities were assessed in isolated rat liver
mitochondria. Enzymatic colorimetric activity kits (Assay Designs Inc, Michigan, USA) were
used in these determination following the manufacturer´s instruction with slight
modifications as described previously (Valdecantos et al 2010). Total, reduced (GSH) and
oxidized (GSSG) glutathione levels were measured in the same samples using a colorimetric
assay (Assay Designs Inc, Michigan, USA). The ratio between GSH and GSSG was also
calculated as a marker of antioxidant status in both erythrocytes and the hepatic
mitochondrial compartment.
4.2.3.9 Statistical analysis
The effects of diet, LA treatment or interaction were evaluated using a two way Anova test.
When interactions were significant, the effects were evaluated using one way Anova
followed by the Bonferroni post‐hoc test. Relationships between variables were analyzed
by calculating Pearson correlation coefficients as all variables followed a normal
Capítulo 4.2 Resultados II Chapter 4.2 Results II
286
distribution as verified by two different methods (Kolmogorov‐Smirnov and Shapiro‐Wilk
tests). All statistical analysis was performed using the GraphPad Prism 5.0 software
(GraphPad Software Inc., San Diego, USA). Differences were considered as statistically
significant at P<0.05. Variables analyzed and presented in figures are unique and did not
require a multiple comparison correction.
4.2.4 RESULTS
4.2.4.1 Effects of high fat diet and lipoic acid on the liveR
As expected, significant increases in body weight gain, and ectopic fat accumulation in the
liver were observed. Increase in hepatic oxidative damage was also observed in obese rats
after ingestion of a high‐fat diet. These effects were significantly prevented by LA
supplementation (Table 1). Thus, LA supplementation of standard di et also diminished
body weight gain, hepatic triglyceride content and TBARS levels as compared with the
control group. Interestingly, a strong interaction between diet and treatment was observed
in the actions of LA on ectopic fat storage in the liver and in hepatic oxidative damage
(Table 1).
Chapter 4.2 Results II Capítulo 4.2 Resultados II
287
Table 1: Effects of diet and lipoic acid on obesity and oxidative injury markers.
CONTROL CLIP OBESE OLIP ANOVA 2x2 ANOVA
DIET LA D*LA
Initial body weight (g) 215±20.3 215±22.3 218±17.8 211±21.6 n.s n.s n.s 0.9206
Body weight gain (g) 177±26.3 106±20.7 264±36.9 167±38.9 <0.001 <0.001 n.s <0.001
Liver triglycerides (%) 3.6±1.05 2.5±0.65* 9.2±0.78*** 2.5±0.63*,### <0.001 <0.001 <0.001 <0.001
TBARS (µmoles/mg tissue) 4.6±0.50 3.3±0.50*** 6.9±7.74*** 2.9±0.47***,### <0.001 <0.001 <0.001 <0.001
mtDNA oxidative injury 0.76±0.05 0.66±0.05 0.84±0.06 0.75±0.04 <0.01 <0.001 n.s <0.001
Values are means ± SE. *P<0.05, ***P<0.001 vs control group; ###P<0.001 vs obese group according to one way Anova followed by post‐hoc multiple
comparisons correction with Bonferroni test.
Capítulo 4.2 Resultados II Chapter 4.2 Results II
288
4.2.4.2 Effects of high fat diet and lipoic acid on oxidative generated mtDNA damage
We analyzed oxidative generated mtDNA damage by q‐RT‐qPCR and observed that, as
expected, high fat intake induced an increase in oxidative injury to mtDNA (Table 1) which
was completely reversed by LA treatment. This protective effect was independent of type
of diet, as statistically significant differences between the C and CLIP group were found
(P<0.001).
4.2.4.3 Erythrocyte antioxidant defences in obesity and LA‐treated animals
The analysis of antioxidant defences in erythrocytes revealed that the consumption of a
high‐fat diet induced a significant inhibitory effect (‐51.32%) in Sod dismutase activity
(Figure 1.A), although no significant effects were observed in Gpx activity (Figure 1.B) or in
the GSH:GSSG ratio (Figure 1.C). In contrast, LA supplementation is able to reverse the
effects of obesity in Sod activity (+122.44% vs OB group) as well to induce an increase in the
activity of this enzyme when supplemented in a standard diet (+78.78%). Moreover, LA
induced an important increase in Gpx activity and also in the GSH:GSSG ratio when it was
added to the standard diet and also in the HFD regimen. Interestingly, a important
interaction (P<0.001) between diet and treatment was observed in the GSH:GSSG ratio
values (Figure 1.C). Thus, the stimulatory effects of this molecule are stronger when it is
administered with a HFD (29.93% in CLIP vs 126.63% in OLIP).
Chapter 4.2 Results II Capítulo 4.2 Resultados II
289
Figure 1: Effects of HFD and LA on erythrocyte antioxidant defences. (A) Superoxide activity (SOD), (B)
Glutathione peroxidise (Gpx) activity and (C) GSH:GSSG ratio. Values are mean±SE. *P<0.05, ***P<0.001
vs control group; ###P<0.001 vs obese group according to one way Anova followed by post‐hoc multiple
comparisons correction with Bonferroni test.
4.2.4.4 Effects on liver mitochondrial antioxidant defences in obesity and LA‐treated
animals
A statistical effect of HFD on Sod2 activity (P<0.01) was found. In fact, the activity of this
enzyme was inhibited (‐26.29%) in obese animals. Moreover, the effect of LA on this
enzyme was higher than the HFD (P<0.001) and was able to activate Sod2 when given with
a standard diet (34.35%) and also with a high‐fat diet (50.50%). As for the effect of HFD and
LA on mtGpx activity and the GSH:GSSG ratio, our data showed an important interaction
between HFD and LA (P<0.05; P<0.001 respectively). Therefore, HFD induced a strong
reduction in mtGpx (30.91%) and also in the GSH:GSSG ratio (56.19%). Moreover, LA was
able to reverse these effects on mtGpx and the GSH:GSSG ratio and increase these values to
higher levels (42.82% ; 139.88 % respectively OLIP vs C). Although, LA was also able to
Capítulo 4.2 Resultados II Chapter 4.2 Results II
290
stimulate significantly mtGpx activity (36.75%; P<0.05) and the GSH:GSSG ratio (114.32%;
P<0.001) when included in a standard diet, our data showed that these effects were
stronger with HFD suggesting that LA actions could be modulated by the fat content of the
diet.
4.2.4.5 Correlations between erythrocytes and liver mitochondrial antioxidant
defences
Erythrocyte antioxidant defences significantly correlated with the hepatic triglyceride
content (Figure 2). Additionally, and more importantly, hepatic TBARS levels (Figure 3) and
mtDNA damage (Figure 4), a robust markers of oxidative damage, were highly associated
with Sod and Gpx activities and also with the GSH:GSSG ratio in erythrocytes, which could
suggest the potential role of erythrocyte antioxidant defences as biomarkers of liver
oxidative damage. Interestingly, all antioxidant defences assessed in erythrocytes and in the
hepatic mitochondrial compartment were positively correlated (Figure 5).
Figure 2: Correlation between erythrocyte antioxidant defences and liver triglyceride content
(A) Sod activity, (B) Gpx activity, (C) GSH:GSSG ratio. r=Pearson correlation coefficient;
r2=goodness of fit.
Chapter 4.2 Results II Capítulo 4.2 Resultados II
291
Figure 3: Correlation between erythrocyte antioxidant defences and TBARS content in liver (A) Sod
activity, (B) Gpx activity, (C) GSH:GSSG ratio. r=Pearson correlation coefficient; r2=goodness of fit.
Figure 4: Correlation between erythrocyte antioxidant defences and mtDNA oxidative injury (A) Sod
activity, (B) Gpx activity, (C) GSH:GSSG ratio. r=Pearson correlation coefficient; r2=goodness of fit.
Capítulo 4.2 Resultados II Chapter 4.2 Results II
292
Figure 5: Correlation between the main antioxidant defences analyzed in erythrocytes and in
the hepatic mitochondrial compartment. (A) Superoxide activity, (B) Glutathione peroxidase
activity and (C) GSH:GSSG ratio. r=Pearson correlation coefficient; r2= goodness of fit.
4.2.5 DISCUSSION
The spectrum of NAFLD features ranges from asymptomatic steatosis to NASH and cirrhosis
(Krawczyk, Bonfrate and Portincasa 2010). In general, the prognosis for simple steatosis is
very good; however, NASH can progress to cirrhosis and hepatocellular carcinoma in 10% to
15% of patients (Rombouts and Marra 2010). Moreover, non invasive methods (e.g.,
abdominal ultrasonography) are safe ways to support a diagnosis of hepatic steatosis, but
advanced liver histopathologic findings including NASH and fibrosis cannot be identified
without performing liver biopsies (Cortez‐Pinto and Camilo 2004, Adams and Feldstein
2011). Given the positive prognosis of steatosis and the difficulty in treating NASH, it is
important to find non invasive methods to predict the progression of NAFLD to NASH based
on the pathogenesis of NAFLD/NASH. From this point of view, our study reports, for the
first time, that erythrocyte antioxidant defences are highly correlated with antioxidant
status in the hepatic mitochondrial compartment and liver oxidative damage under
different antioxidant conditions. These data highlight the possibility of evaluating the
Chapter 4.2 Results II Capítulo 4.2 Resultados II
293
oxidative balance in the hepatic mitochondrial compartment just through blood samples
instead of using liver biopsies.
NAFLD is now considered the main hepatic manifestation of obesity and metabolic
syndrome (Carmiel‐Haggai, Cederbaum and Nieto 2005, Lewis and Mohanty 2010). In fact,
our data demosnstrate that high fat feeding increased body weight gain and subsequently
induced liver steatosis. Further events in the liver include oxidative stress and the decrease
in antioxidant defenses induced by early mitochondrial dysfunction (Abdel‐Wahab et al
2002, Gambino, Musso and Cassader 2011). Thus, oxidative stress represents an imbalance
between the production and manifestation of ROS and the antioxidant defenses that are
able to readily detoxify the reactive intermediates or to repair the resulting damage
(Furukawa et al 2004, Valdecantos, Perez‐Matute and Martinez 2009, Vincent and Taylor
2006).
Disturbances in the normal redox state can cause injury in other cell components, including
lipids. Indeed, several studies have described an increase in TBARS content, a good marker
of lipid oxidative damage, in steatotic livers (Park et al 2011, Caito et al 2010). Accordingly,
in this study obese animals presented an increase in TBARS levels that was prevented by LA
treatment, suggesting that the HFD produced an increase in hepatic oxidative stress,
inducing oxidative damage in lipids.
Furthermore, oxidative damage of mitochondrial DNA has been correlated with several
diseases such as neurodegenerative disease (Cortopassi et al 1992, Michikawa et al 1999),
cancer (Brunet et al 2004, Rohan et al 2010) or diabetes (Madsen‐Bouterse et al 2010).
Moreover, mtDNA is more susceptible to oxidative injury than nuclear DNA due to its
localization near to the site of free radical generation (Ballinger et al 1999). Accordingly,
our data showed that a decrease in antioxidant defenses in the hepatic mitochondrial
compartment of obese animals was associated with enhanced mtDNA oxidative generated
damage and LA treatment is able to reverse the deleterious effect in mtDNA, corroborating
its beneficial effects on oxidative stress in liver mitochondria after the ingestion of a high‐
fat diet.
There is no established treatment for NAFLD except for weight loss and treatments that
prevent obesity and metabolic syndrome. In this context, LA exerts beneficial physiological
Capítulo 4.2 Resultados II Chapter 4.2 Results II
294
effects such as: attenuation of oxidative stress (Maritim, Sanders and Watkins 2003),
modulation of glucose metabolism (Sadi, Yilmaz and Guray 2008), prevention of body
weight gain induced by HFD (Wollin et al 2004) as well as a reduction of energy efficiency
(Prieto‐Hontoria 2009). Our results confirm that LA treatment is able to prevent body
weight gain and attenuate oxidative stress through the stimulation of antioxidant defences,
both systemic and in the hepatic mitochondrial compartment, specially the GSH:GSSG ratio,
whose role as a regulator of antioxidant status in mitochondria has been described
(Kimura, Goto and Kimura 2010, Muyderman et al 2007).
Furthermore, previous experiments have revealed that liver oxidative stress plays a central
role in several hepatic disorders (Copple, Jaeschke and Klaassen 2010). In addition, other
studies have demonstrated an association between liver disease and systemic oxidative
stress (Ljubuncic, Tanne and Bomzon 2000, Powell, Jonsson and Clouston 2010). Moreover,
the central role of mitochondrial changes and oxidative stress in the evolution of fatty‐liver
linked to obesity (Perez‐Carreras et al 2003, Rector et al 2010) suggest that mitochondrial
antioxidant status is a fine predictor of the pathological development of an important liver
complication of obesity. However, liver biopsy is necessary to assess mitochondrial
antioxidant status and consequently to predict progression of NAFLD to NASH.
Interestingly, our data showed a strong correlation between antioxidant biomarkers in
erythrocytes and the liver mitochondrial compartment under different antioxidant status
conditions and highlight the possibility of using erythrocytes as non‐invasive biomarker of
the progression of NAFL to NASH instead of liver biopsy.
4.2.6 CONCLUSIONS
In conclusion, our results show that the assessment of the activity of antioxidant defences
(such as Sod and Gpx) and the GSH:GSSG ratio in erythrocytes could be used as good
markers of the antioxidant status of the hepatic mitochondrial compartment and,
consequently, they could be good predictors of the development of non‐alcoholic fatty‐liver
disease after a high fat diet. In addition, LA treatment is able to prevent the impairment of
systemic and hepatic mitochondrial antioxidant defences induced by a high‐fat diet intake.
Chapter 4.2 Results II Capítulo 4.2 Resultados II
295
Acknowledgments
We would like to thank acknowledge Ana Lorente and Veronica Ciaurriz for their technical
assistance. We also thank Paul Miller from the Department of Modern Languages
(University of Navarra) for the English scientific revision. This work has been supported by
Línea especial “Nutrición, Obesidad y Salud” (University of Navarra LE/97) and Ministry of
Science and Innovation (AGL2006‐04716/ALI and AGL2009‐10873/ALI). MP. Valdecantos
holds a scholarship from “Instituto de Salud Carlos III” (ISCIII) (Spanish Ministry of Health).
Also CIBER and RETICS networks are gratefully credited.
Capítulo 4.2 Resultados II Chapter 4.2 Results II
296
4.2.7 REFERENCES
Abdel‐Wahab YH, O'Harte FP, Mooney MH, Barnett CR and Flatt PR. (2002). Vitamin C
supplementation decreases insulin glycation and improves glucose homeostasis in obese
hyperglycemic (ob/ob) mice. Metabolism. 51, 514‐7.
Adams LA and Feldstein AE. (2011). Non‐invasive diagnosis of nonalcoholic fatty liver and
nonalcoholic steatohepatitis. J Dig Dis. 12, 10‐6.
Ballinger SW, Van Houten B, Jin GF, Conklin CA and Godley BF. (1999). Hydrogen peroxide
causes significant mitochondrial DNA damage in human RPE cells. Exp Eye Res. 68, 765‐
72.
Brand MD. (2010). The sites and topology of mitochondrial superoxide production. Exp
Gerontol. 45, 466‐72.
Brunet A, Sweeney LB, Sturgill JF, Chua KF, Greer PL, Lin Y, Tran H, Ross SE, Mostoslavsky R,
Cohen HY, Hu LS, Cheng HL, Jedrychowski MP, Gygi SP, Sinclair DA, Alt FW and
Greenberg ME. (2004). Stress‐dependent regulation of FOXO transcription factors by the
Sirt1 deacetylase. Science. 303, 2011‐5.
Caito S, Hwang JW, Chung S, Yao H, Sundar IK and Rahman I. (2010). Parp‐1 inhibition does
not restore oxidant‐mediated reduction in Sirt1 activity. Biochem Biophys Res Commun.
392, 264‐70.
Canto C, Gerhart‐Hines Z, Feige JN, Lagouge M, Noriega L, Milne JC, Elliott PJ, Puigserver P
and Auwerx J. (2009). AMPK regulates energy expenditure by modulating NAD+
metabolism and Sirt1 activity. Nature. 458, 1056‐60.
Carmiel‐Haggai M, Cederbaum AI and Nieto N. (2005). A high‐fat diet leads to the
progression of non‐alcoholic fatty liver disease in obese rats. Faseb J. 19, 136‐8.
Cohen JC, Horton JD and Hobbs HH. (2011). Human fatty liver disease: old questions and
new insights. Science. 332, 1519‐23.
Copple BL, Jaeschke H and Klaassen CD. (2010). Oxidative stress and the pathogenesis of
cholestasis. Semin Liver Dis. 30, 195‐204.
Cortez‐Pinto H and Camilo ME. (2004). Non‐alcoholic fatty liver disease/non‐alcoholic
steatohepatitis (NAFLD/NASH): diagnosis and clinical course. Best Pract Res Clin
Gastroenterol. 18, 1089‐104.
Chapter 4.2 Results II Capítulo 4.2 Resultados II
297
Cortopassi GA, Shibata D, Soong NW and Arnheim N. (1992). A pattern of accumulation of a
somatic deletion of mitochondrial DNA in aging human tissues. Proc Natl Acad Sci U S A.
89, 7370‐4.
Donnelly KL, Smith CI, Schwarzenberg SJ, Jessurun J, Boldt MD and Parks EJ. (2005). Sources
of fatty acids stored in liver and secreted via lipoproteins in patients with nonalcoholic
fatty liver disease. J Clin Invest. 115, 1343‐51.
Furukawa S, Fujita T, Shimabukuro M, Iwaki M, Yamada Y, Nakajima Y, Nakayama O,
Makishima M, Matsuda M and Shimomura I. (2004). Increased oxidative stress in obesity
and its impact on metabolic syndrome. J Clin Invest. 114, 1752‐61.
Gambino R, Musso G and Cassader M. (2011). Redox Balance in the Pathogenesis of
Nonalcoholic Fatty Liver Disease: Mechanisms and Therapeutic Opportunities. Antioxid
Redox Signal.
Kalahasthi RB, Hirehal Raghavendra Rao R and Bagalur Krishna Murthy R. (2006). Plasma
lipid peroxidation and erythrocyte antioxidants status in workers exposed to nickel.
Biomarkers. 11, 241‐9.
Kimura Y, Goto Y and Kimura H. (2010). Hydrogen sulfide increases glutathione production
and suppresses oxidative stress in mitochondria. Antioxid Redox Signal. 12, 1‐13.
Krawczyk M, Bonfrate L and Portincasa P. (2010). Nonalcoholic fatty liver disease. Best Pract
Res Clin Gastroenterol. 24, 695‐708.
Lewis JR and Mohanty SR. (2010). Nonalcoholic fatty liver disease: a review and update. Dig
Dis Sci. 55, 560‐78.
Ljubuncic P, Tanne Z and Bomzon A. (2000). Evidence of a systemic phenomenon for
oxidative stress in cholestatic liver disease. Gut. 47, 710‐6.
Lowes DA and Galley HF. (2011). Mitochondrial protection by the thioredoxin‐2 and
glutathione systems in an in vitro endothelial model of sepsis. Biochem J. 436, 123‐32.
Madsen‐Bouterse SA, Zhong Q, Mohammad G, Ho YS and Kowluru RA. (2010). Oxidative
damage of mitochondrial DNA in diabetes and its protection by manganese superoxide
dismutase. Free Radic Res. 44, 313‐21.
Maritim AC, Sanders RA and Watkins JB, 3rd. (2003). Effects of alpha‐lipoic acid on
biomarkers of oxidative stress in streptozotocin‐induced diabetic rats. J Nutr Biochem.
14, 288‐94.
Capítulo 4.2 Resultados II Chapter 4.2 Results II
298
Michikawa Y, Mazzucchelli F, Bresolin N, Scarlato G and Attardi G. (1999). Aging‐dependent
large accumulation of point mutations in the human mtDNA control region for
replication. Science. 286, 774‐9.
Millonig G, Praun S, Netzer M, Baumgartner C, Dornauer A, Mueller S, Villinger J and Vogel
W. (2010). Non‐invasive diagnosis of liver diseases by breath analysis using an optimized
ion‐molecule reaction‐mass spectrometry approach: a pilot study. Biomarkers. 15, 297‐
306.
Monari M, Trinchero A, Calabrese C, Cattani O, Serrazanetti GP, Foschi J, Fabbri A, Zahlane
D, Di Febo G, Tonini V, Cervellera M, Tosi MR and Tugnoli V. (2006). Superoxide
dismutase in gastric adenocarcinoma: is it a clinical biomarker in the development of
cancer? Biomarkers. 11, 574‐84.
Muyderman H, Wadey AL, Nilsson M and Sims NR. (2007). Mitochondrial glutathione
protects against cell death induced by oxidative and nitrative stress in astrocytes. J
Neurochem. 102, 1369‐82.
Ozden O, Park SH, Kim HS, Jiang H, Coleman MC, Spitz DR and Gius D. (2011). Acetylation of
Sod2 directs enzymatic activity responding to cellular nutrient status or oxidative stress.
Aging (Albany NY). 3, 102‐7.
Park HJ, DiNatale DA, Chung MY, Park YK, Lee JY, Koo SI, O'Connor M, Manautou JE and
Bruno RS. (2011). Green tea extract attenuates hepatic steatosis by decreasing adipose
lipogenesis and enhancing hepatic antioxidant defenses in ob/ob mice. J Nutr Biochem.
22, 393‐400.
Pavao ML, Figueiredo T, Santos V, Lopes PA, Ferin R, Santos MC, Neve J and Viegas‐Crespo
AM. (2006). Whole blood glutathione peroxidase and erythrocyte superoxide dismutase
activities, serum trace elements (Se, Cu, Zn) and cardiovascular risk factors in subjects
from the city of Ponta Delgada, Island of San Miguel, The Azores Archipelago, Portugal.
Biomarkers. 11, 460‐71.
Perez‐Carreras M, Del Hoyo P, Martin MA, Rubio JC, Martin A, Castellano G, Colina F,
Arenas J and Solis‐Herruzo JA. (2003). Defective hepatic mitochondrial respiratory chain
in patients with nonalcoholic steatohepatitis. Hepatology. 38, 999‐1007.
Perez‐Echarri N, Perez‐Matute P, Marcos‐Gomez B, Marti A, Martinez JA and Moreno‐Aliaga
MJ. (2009). Down‐regulation in muscle and liver lipogenic genes: EPA ethyl ester
treatment in lean and overweight (high‐fat‐fed) rats. J Nutr Biochem. 20, 705‐14.
Chapter 4.2 Results II Capítulo 4.2 Resultados II
299
Pessayre D. (2007). Role of mitochondria in non‐alcoholic fatty liver disease. J Gastroenterol
Hepatol. 22 Suppl 1, S20‐7.
Powell EE, Jonsson JR and Clouston AD. (2010). Metabolic factors and non‐alcoholic fatty
liver disease as co‐factors in other liver diseases. Dig Dis. 28, 186‐91.
Prieto‐Hontoria PL, Pérez‐Matute P., Fernández‐Galilea M., Martínez J.A., Moreno‐Aliaga
M.J.. (2009). Lipoic acid prevents body weight gain induced by a high fat diet in rats:
Effects on intestinal sugar transport. Journal of Physiology and Biochemestry. 65, 43‐50.
Rector RS, Thyfault JP, Uptergrove GM, Morris EM, Naples SP, Borengasser SJ, Mikus CR,
Laye MJ, Laughlin MH, Booth FW and Ibdah JA. (2010). Mitochondrial dysfunction
precedes insulin resistance and hepatic steatosis and contributes to the natural history
of non‐alcoholic fatty liver disease in an obese rodent model. J Hepatol. 52, 727‐36.
Rickwood D, Darley‐Usmar VM and Wilson MT 1987. Mitochondria a practical approach. In:
DARLEY‐USMAR, VM, RICKWOOD, D & WILSON, MT (eds.). IRL Press Oxford.
Rohan TE, Wong LJ, Wang T, Haines J and Kabat GC. (2010). Do alterations in mitochondrial
DNA play a role in breast carcinogenesis? J Oncol. 2010, 604304.
Rombouts K and Marra F. (2010). Molecular mechanisms of hepatic fibrosis in non‐alcoholic
steatohepatitis. Dig Dis. 28, 229‐35.
Sadi G, Yilmaz O and Guray T. (2008). Effect of vitamin C and lipoic acid on streptozotocin‐
induced diabetes gene expression: mRNA and protein expressions of Cu‐Zn Sod and
catalase. Mol Cell Biochem. 309, 109‐16.
Simula MP and De Re V. (2010). Hepatitis C virus‐induced oxidative stress and
mitochondrial dysfunction: a focus on recent advances in proteomics. Proteomics Clin
Appl. 4, 782‐93.
Solga SF, Alkhuraishe A, Cope K, Tabesh A, Clark JM, Torbenson M, Schwartz P, Magnuson T,
Diehl AM and Risby TH. (2006). Breath biomarkers and non‐alcoholic fatty liver disease:
preliminary observations. Biomarkers. 11, 174‐83.
Torsdottir G, Kristinsson J, Snaedal J, Sveinbjornsdottir S, Gudmundsson G, Hreidarsson S
and Johannesson T. (2010). Case‐control studies on ceruloplasmin and superoxide
dismutase (SOD1) in neurodegenerative diseases: a short review. J Neurol Sci. 299, 51‐4.
Valdecantos MP, Perez‐Matute P and Martinez JA. (2009). [Obesity and oxidative stress:
role of antioxidant supplementation]. Rev Invest Clin. 61, 127‐39.
Capítulo 4.2 Resultados II Chapter 4.2 Results II
300
Valdecantos MP, Perez‐Matute P, Quintero P and Martinez JA. (2010). Vitamin C,
resveratrol and lipoic acid actions on isolated rat liver mitochondria: all antioxidants but
different. Redox Rep. 15, 207‐16.
Vincent HK and Taylor AG. (2006). Biomarkers and potential mechanisms of obesity‐
induced oxidant stress in humans. Int J Obes (Lond). 30, 400‐18.
Wollin SD, Wang Y, Kubow S and Jones PJ. (2004). Effects of a medium chain triglyceride oil
mixture and alpha‐lipoic acid diet on body composition, antioxidant status, and plasma
lipid levels in the Golden Syrian hamster. J Nutr Biochem. 15, 402‐10.
Wree A, Kahraman A, Gerken G and Canbay A. (2011). Obesity affects the liver ‐ the link
between adipocytes and hepatocytes. Digestion. 83, 124‐33.
CAPÍTULO 4.3/CHAPTER 4.3
Lipoic acid administration prevents non‐alcoholic steatosis
linked to long term high‐fat feeding by modulating
mitochondrial function
Published in Journal of Nutritional Biochemistry (In press)
Chapter 4.3 Results III Capítulo 4.3 Resultados III
4.3 LIPOIC ACID PREVENTS NON‐ALCOHOLIC STEATOSIS
Capítulo 4.3 Resultados III Chapter 4.3 Results III
304
4.3.1 ABSTRACT
Non‐alcoholic steatosis is an important hepatic complication of obesity linked to
mitochondrial dysfunction and insulin resistance. Furthermore, lipoic acid has been
reported to have beneficial effects on mitochondrial function. In this study, we analyzed the
potential protective effect of lipoic acid supplementation against the development of non‐
alcoholic steatosis associated with a long‐term high‐fat diet feeding and the potential
mechanism of this effect. Wistar rats were fed on a standard diet (n=10), a high‐fat diet
(n=10) and a high‐fat diet supplemented with lipoic acid (n=10). A group pair‐fed to the
latter group (n=6) was also included. Lipoic acid prevented hepatic triglyceride
accumulation and liver damage in rats fed on a high‐fat diet (‐68±11.3% vs obese group),
through the modulation of genes involved in lipogenesis and mitochondrial β‐oxidation,
and be improving insulin sensitivity. Moreover, this molecule showed an inhibitory action
on electron transport chain complexes activities (P<0.01‐P<0.001) and ATP synthesis
(P<0.05), and reduced significantly energy efficiency. By contrast, lipoic acid induced an
increase in mitochondrial copy number and in Ucp2 gene expression (P<0.001 vs obese). In
summary, this investigation demonstrated the ability of lipoic acid to prevent non‐alcoholic
steatosis induced by a high‐fat intake. Finally, the novelty and importance of this study is
the finding of how lipoic acid modulates some of the mitochondrial processes involved in
energy homeostasis. The reduction in mitochondrial energy efficiency could also explain, at
least in part, the beneficial effects of lipoic acid not only in fatty liver but also in preventing
excessive body weight gain.
Keywords: mitochondrial dysfunction; high‐fat diet; oxidative‐phosphorylation; energy
efficiency; obesity; energy homeostasis; steatosis; triglyceride synthesis; insulin resistance.
Abbreviations: NASH; non alcoholic steatohepatitis; HFD, high‐fat diet; LA, α‐Lipoic acid;
ATP, adenosine triphosphate; LASY, lipoic acid synthase; AMPK, adenosine
monophosphate‐activated protein kinase; mtDNA, mitochondrial DNA; ETC, electron
transport chain; OXPHOS, oxidative‐phosphorylation.
Chapter 4.3 Results III Capítulo 4.3 Resultados III
RESUMEN
La esteatosis no alcohólica es una importante complicación de la obesidad ligada a una
disfunción mitocondrial y a la resistencia a la insulina. Por otro lado, se ha descrito que el
ácido lipoico posee efectos beneficiosos sobre la funcionalidad mitocondrial. En este
estudio se analizó el potencial papel protector de la suplementación con ácido lipoico
frente al desarrolló de esteatosis no alcohólica asociada a la ingesta de una dieta alta en
grasa y los mecanismos implicados. Para ello ratas Wistar macho fueron alimentadas con
una dieta estándar (n=10), una dieta alta en grasa (n=10) y una dieta alta en grasa
suplementada con ácido lipoico (n=10). Además, se introdujo un grupo pair‐fed respecto al
grupo suplementado con ácido lipoico (n=6). El ácido lipoico previno la acumulación de
triglicéridos en el hígado y el daño oxidativo en las dietas respecto a los animales
alimentados con una dieta alta en grasa (‐68±11.3% vs grupo obeso), a través de la
modulación de la expresión de genes implicados en la lipogénesis y la β‐oxidación
mitocondrial, y por una mejora en la sensibilidad a la insulina. Además, esta molécula
mostró un efecto inhibitorio en la actividad de los complejos de la cadena de transporte de
electrones (P<0.01‐P<0.001) y en la síntesis de ATP (P<0.05), y redujo significativamente la
eficiencia energética. Por el contrario, el ácido lipoico indujo un incremento en el número
de copias de mtDNA y en la expresión de Ucp2 (P<0.001 vs grupo obeso). En resumen, esta
investigación demuestra la capacidad del ácido lipoico para prevenir la esteatosis hepática
no alcohólica inducida por una dieta alta en grasa. Finalmente, la aportación más novedosa
e importante del presente estudio es como el ácido lipoico modula varios procesos de la
homeostasis energética mitocondrial. La disminución observada en la eficiencia energética
también puede explicar, al menos en parte, los efectos beneficiosos del ácido lipoico no
sólo en el hígado graso sino también en la prevención de una excesiva ganancia de peso.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
306
4.3.2 INTRODUCTION
Fatty liver or steatosis refers to a histopathological condition in which an excessive
accumulation of lipids, primarily triglycerides, within hepatocytes occurs (Burt, Mutton and
Day 1998). This disease is generally considered as one of the main causes of hepatic
dysfunction and an important manifestation of the metabolic syndrome and obesity
(Carmiel‐Haggai, Cederbaum and Nieto 2005). Because of the crucial importance of this
organ in metabolism and homeostasis, alterations in hepatic function have an impact on
the whole organism and could be responsible for several complications derived from the
consumption of rich fat diets, including obesity.
Accumulating evidence indicates that insulin resistance (Sanyal et al 2001) and an impaired
mitochondrial function (Perez‐Carreras et al 2003, Rector et al 2010) plays a central role in
the development of non‐alcoholic steatosis. In fact, a constellation of mitochondrial
abnormalities such as: impaired mitochondrial oxidation capacity, significant mitochondrial
structural abnormalities, hypertrophy of the microsomal oxidative function, increased
activity of the cytochrome P‐450 system and generation of free oxygen radicals were
described in non‐alcoholic steatohepatitis (NASH) livers (Pessayre et al 2001, Robertson,
Leclercq and Farrell 2001). In this sense, it is well known that a high‐fat diet (HFD) cause
alterations in hepatic mitochondrial compartment (Raffaella et al 2008, Mollica et al 2009).
α‐Lipoic acid (LA) is a natural compound derived from octanoic acid. It is present in a wide
variety of plants and animals and synthesized through a reaction catalyzed by lipoic acid
synthase (LASY) within the mitochondria (Padmalayam et al 2009). Also, LA acts as a
cofactor of several mitochondrial bioenergetic enzymes (Reed 1998) and in several
processes of aerobic metabolism. Apart from its role in the mitochondria, when
supplemented in diets, LA exerts beneficial physiological effects such as: attenuation of
oxidative stress (Maritim, Sanders and Watkins 2003), overcoming of ageing decay
(McCarty, Barroso‐Aranda and Contreras 2009), modulation of glucose metabolism (Sadi,
Yilmaz and Guray 2008), prevention of body weight gain induce by HFD (Wollin et al 2004),
as well as, a reduction of energy efficiency (Prieto‐Hontoria 2009). In addition, the ability of
LA to reduce serum and tissue lipid levels has been reported by other investigators
(Timmers et al 2010, Chiu, Tsao and Yang 2009). Moreover, it has been demonstrated that
LA decreases hepatic lipogenesis, although the underlying mechanisms are not completely
understood (Bortolato, Chen and Shih 2008).
Chapter 4.3 Results III Capítulo 4.3 Resultados III
In the light of the above considerations, we suggest that LA treatment may have a
protective effect against the development of fatty liver associated with a long‐term
high‐fat diet feeding through the modulation of mitochondrial function and lipid
metabolism pathways. To test this hypothesis, we evaluated several parameters of
ectopic lipid storage in the liver, mitochondrial function and lipid metabolism in rats fed
with HFD supplemented with LA.
4.3.3 METHODS AND MATERIALS
4.3.3.1 Animals and diets
Male Wistar rats (n=36) aged six weeks were supplied from the Applied Pharmacology
Research Center (CIFA, Pamplona, Spain). Animals were housed in cages in temperature‐
controlled room (22 ±2˚C) with a 12‐hour light‐dark cycle, fed a pelleted chow diet and
given deionised water ad libitum for an adaptation period of 5 days. After this period,
rats were assigned into 4 experimental groups for 8 weeks. The Control group (n=10),
was fed on a standard diet (4.6% w/w of lipids), commercially available (Harlam Tekland
Global Diets, USA). The obese group (OB) (n=10) was fed with ad libitum high‐fat diet
(60% w/w of lipids); the OLIP (Obese + Lipoic acid) group (n=10) was fed with ad libitum
HFD (same as Obese Group) supplemented with LA in a proportion of 0.25 g LA/100 g of
diet, as previously described (Prieto‐Hontoria 2009); the pair‐fed OLIP group (PFO) (n=6)
was fed with the same amount of HFD eaten by OLIP group but without adding LA. Body
weight and food intake were recorded every 2‐3 days. At the end of the experimental
period, rats were euthanized and blood and tissue samples were immediately collected,
frozen in liquid nitrogen and kept at ‐80˚C. All experimental procedures were performed
according to National and Institutional Guidelines for Animal Care and Use at the
University of Navarra.
4.3.3.2 Tissue homogenization procedure and mitochondrial isolation
Livers were quickly excised after sacrificing the animals and either frozen in liquid
nitrogen or placed in ice‐cold buffer (250 mM sucrose, 1 mM EDTA and 5 mM NaTES,
pH=7.4). Fresh tissue placed in buffer was used to prepare mitochondrial suspension
according to modified method of Rickwood et al (1987) (Rickwood, Darley‐Usmar and
Wilson 1987) with slight modifications as previously described by Valdecantos et al
(2010) (Valdecantos et al 2010).
Capítulo 4.3 Resultados III Chapter 4.3 Results III
308
4.3.3.3 Blood samples and biochemical parameters
Blood was drawn into Vacutainer tubes containing gel without additives (Vacutainer Gel
SST II). Serum samples were prepared after centrifugation for 15 min at 2200 g at 4˚C,
supernatant was collected, immediately frozen and kept at ‐80˚C. Transaminases serum
levels were determined using a COBAS‐Mira analyzer (Roche Diagnostics, Switzerland).
Serum insulin levels were measured by ELISA for rat/ mouse Insulin ELISA kit (Linco, St.
Charles,MI, USA). Serum glucose levels were assayed using a Cobas Mira Autoanalyzer
(Roche Diagnostic, Basel, Swiss), as previously described (Perez‐Matute et al 2007).
4.3.3.4 Hepatic triglyceride content
To determine the hepatic triglyceride (TG) content, 150 mg of these tissues were
sonicated in a Branson Sonifier 250 equipment (Duty cycle 40%; Output control 4; Hold
Continuous) for 40 seconds in 1.5 ml of buffer (150 mM NaCl, 0,1% Triton and 10 mM
Tris (pH 8)) at 50˚C. After centrifugation at 12000g for 10 min, the obtained supernatant
was used to measure the TG levels using a COBAS‐Mira analyzer (Roche Diagnostics,
Switzerland) as described elsewhere (Perez‐Echarri et al 2009).
4.3.3.5 Morphological evaluation
For histopathological analysis, liver specimens fixed in 4% of paraformaldehyde
were embedded in paraffin, sliced 10 µm thicknesses, and stained with hematoxylin
and eosin staining for detection of hepatic steatosis, inflammation and
morphological changes following routine procedures. Moreover, liver slices were
stained with Sirius Red staining to determine collagen fibers. The pathological
changes were assessed and photographed under a Nikon eclipse E800 microscope
(Nikon Corporation, Japan).
4.3.3.6 Real‐time quantitative PCR
Total RNA was isolated from liver using Trizol® reagent (Invitrogen, USA) and according
to the manufacturer’s instructions. RNA concentrations were determined by Nanodrop
1000 (Nanodrop, USA). To avoid contamination with genomic DNA, DNA digestion and
inactivation were assessed using the DNAse kit (Ambion Inc, USA). Four micrograms of
RNA were reverse transcribed to cDNA using the M‐MLV kit (Invitrogen, USA) following
instructions from the suppliers.
Chapter 4.3 Results III Capítulo 4.3 Resultados III
Fourteen genes were analyzed (Table 1) using predesigned TaqMan® Assays‐on‐ demand
fixed on a low density array microplates (Applied Byosistems, USA). The reaction
conditions were set up according to the manufacturer's instructions. Amplification and
detection of specific products were performed using the ABI PRISM 7900HT Sequence
Detection System (Applied Biosystems, USA). All the samples were analyzed in duplicate.
CT values were generated by the ABI software. Finally, the relative expression levels of
each gene were calculated with 2‐∆∆CT method, previously reported (Perez‐Matute et al
2009). Hepatic expression levels of each gene were normalized by β‐Actin. The ratio
between mitochondrial encoded gen (Mtco2) and nuclear endogenous gene (18s) was
used to calculate the mitochondrial copy number.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
310
Table 1: Gene name and GenBank accession number used in RT‐qPCR
Gen symbol
GenBank number
Gene name Gene function
Atp5c1 NM_053825.1 ATP synthase, H+ transporting, mitochondrial F1 complex, gamma polypeptide 1
ATP synthesis
Ucp2 NM_019354.2 Uncoupling protein 2 Energy expenditure
Srebp1 XM_213329.5 Sterol regulatory element binding transcription factor 1
Lipogenesis (regulation)
Dgat2 NM_001012345.1 Diacylglycerol O‐acyltransferase homolog 2
Triglyceride synthesis
Acadl NM_012819.1 Acyl‐Coenzyme A dehydrogenase, long‐chain
Mitochondrial β‐oxidation
Acox1 NM_017340.2 Acyl‐Coenzyme A oxidase 1, palmitoyl Peroxisomal β‐oxidation
Cpt1 NM_031559.2 Carnitine palmitoyltransferase 1a Mitochondrial β‐oxidation
Ppara NM_013196.1 Peroxisome proliferator activated receptor alpha ( Pparα)
Lipid metabolism (regulation)
Pparg NM_013124.3 Peroxisome proliferator‐activated receptor gamma (Pparγ)
Lipid metabolism (regulation)
Ppargc1a NM_031347.1 Peroxisome proliferator‐activated receptor gamma, coactivator 1 alpha (Pgc‐1α)
Mitochondrial function (regulation)
Ppargc1b NM_176075.2 Peroxisome proliferator‐activated receptor gamma, coactivator 1 beta (Pgc‐1β)
Mitochondrial function (regulation)
Mtco2 MIM_516040 Cytochrome c oxidase subunit 2 Mitochondrial encoded gen
4.3.3.7 Complex I, Complex II+III, succinate dehydrogenase activities
Assays of the activities of these enzymes were carried out in frozen isolated
mitochondria using a kinetic method in a Multiskan Spectrum spectrophotometer
(Thermo Electron Corporation, USA), through standardized reproducible methods as
described elsewhere (Aleardi et al 2005, Benard et al 2006). All activities were
expressed in nmoles per minute and per milligram. Activity measurements were
performed for both complexes using 50 µg of mitochondrial protein.
Chapter 4.3 Results III Capítulo 4.3 Resultados III
4.3.3.8 Complex IV activity and ATP synthase activity
Complex IV and ATP synthase activities were measured in frozen isolated rat liver
mitochondria (25 µg and 75 µg of mitochondrial protein respectively) with a
MitoProfile®Rapid Microplate assay kits according to the manufacturer´s instructions
(Cat. nº MS447 and MS541, respectively. MitoScience, USA). Complex IV and ATP
synthase were immunocaptured within the wells of microplates, and the enzyme activity
was measured by a kinetic colorimetric assay and activities were determined as
previously described (Terni et al 2008, Liu et al 2009).
4.3.3.9 Citrate synthase activity
Citrate synthase activity were measured in frozen isolated mitochondria and in whole
liver homogenate through the monitoring of the reduction of 5,5‐dithiobis (2‐
nitrobenzoic acid) (DTNB) by citrate synthase at 412 nm was followed in coupled
reaction with coenzyme A and oxaloacetate. A reaction mixture of 20 mM HEPES, 0.4
mM of acetyl‐coenzime A, 0.5 mM of oxaloacetate and 0.1 mM of DTNB, the reaction
was initiated by the addition of isolated mitochondria (50 µg). At once, the natural
oxidation of DTNB was measured in the same experimental conditions without
oxaloacetate as a substrate of citrate synthase. This ratio of oxidation was subtracted to
all samples (Benard et al 2006). The ratio between citrate synthase activity in whole
tissue and in isolated mitochondria was used to evaluate mitochondrial protein mass as
described previously by Raffaella et al (2008) (Raffaella et al 2008).
4.3.3.10 Liver mitochondrial ATP content
ATP was determined by the firefly luciferin‐luciferase assay system accordingly to the
method of Lemasters et al (1976) (Lemasters and Hackenbrock 1976). Firstly, we extract
the ATP from mitochondrial matrix according with a protocol (Dorta et al 2005),
previously described by Dorta et al (2005) with minor modifications. Bioluminiscence
was measured in the supernatant with a Proteinkinase sensitive assay kit (Proteinkinase,
Biaffin GmbH & Co KG, Germany), according to the manufacturer´s instructions with
slight modifications and using a Luminoskan Ascent (Thermo Electron Corporation, USA).
4.3.3.11 Statistical analysis
Data are reported as mean ± S.E. Normal distribution was assessed by two different test,
Shapiro‐Wilk and Kolmogorov‐Smirnov. In order to determine the effects of LA
Capítulo 4.3 Resultados III Chapter 4.3 Results III
312
treatment, one way Anova or Kruskal‐Wallis followed by a Bonferroni or Dunns test
respectively were carried out. The P values represented in figures and tables
corresponded to pos‐hoc test. The P values of Anova or Kruskal‐Wallis test appear in
separate column in table and also in the right‐up corner of the figures. Relationships
between variables were analyzed by calculating Pearson correlation coefficients. All
statistical analyses were performed using the GraphPad Prism 5.0 software (GraphPad
Software Inc., San Diego, USA) and SPSS 15.0 software (SPSS Inc, Chicago, USA).
Differences were considered as statistically significant at P<0.05. Variables analyzed and
presented in figures are unique and not required a multiple comparison correction.
4.3.4 RESULTS
4.3.4.1 Effects of LA on body and liver weights and energy efficiency
As expected, an increase in body weight (P<0.001) was observed in rats fed a HFD.
Interestingly, this increase was significantly prevented by LA treatment (P<0.001).
Although no differences between experimental groups were observed in livers weight,
expressed as a percentage of total body weight (Table 2). Energy intake was measured in
order to find out if the differences in body weight gain could be related to differences in
food intake. In this sense, HFD fed rats showed an increase in their calorie intake
(+43±6% vs control group; P<0.001), which was also reduced by LA treatment (‐17±4% vs
obese group; P<0.001). Changes in energy efficiency, calculated as a ratio between body
weight gain and calorie intake, was not observed in the obese group. Furthermore, LA
induced a significant decrease in energy efficiency in the OLIP group in contrast with the
obese group as well as with the PFO group, suggesting that the prevention in body
weight gain could be due, at least in part, to a reduction in energy efficiency and it is not
secondary to calorie restriction (P<0.01 OLIP vs PFO) (Table 2).
Chapter 4.3 Results III Capítulo 4.3 Resultados III
Table 2: Body, liver and WAT weights, biochemical markers, calorie intake and feed
efficiency in lean and obese (high‐fat fed) rats.
CONTROL OBESE OLIP PFO ANOVA
n=10 n=10 n=10 n=6
Final body weight (g) 391.8±12.21 482.0±13.73*** 363.7±14.32###, a 423.2±4.50* <0.001
Liver/body weight (%) 2.48±0.162 2.13±0.101 2.59±0.167 2.13±0.105 0.0386
WAT/body weight (%) 7.2±0.39 13.3±0.58*** 7.2±0.38###,b 9.4±0.39##,* <0.001
Calorie intake (Kcal/day) 69.9±0.68 99.8±1.41*** 83.4±0.99### 81.8±1.19### <0.001
Energy efficiency (g/Kcal*100) 4.2±0.19 4.9±0.11 3.2±0.22##,**, b 4.3±0.19 <0.001
Insulin (ng/ml) 1.1±0.13 2.1±0.16*** 1.0±0.10###,a 1.5±0.04# <0.001
HOMA index 5.9±0.67 13.2±1.37*** 6.5±0.74###,a 10.3±0.75# <0.001
ALT (U/l) 45.1±2.63 60.4±5.37** 36.4±2.82### 39.1±1.84### <0.001
AST (U/l) 136.5±7.42 164.8±4.92** 110.6±4.95##,a 155.8±7.968 0.0022
Values are means ± SE. *P<0.05, **P<0.01, ***P<0.001 vs control group; #P<0.05, ##P<0.01,
###P<0.001 vs obese group; aP<0.05, bP<0.01 vs PFO group according to post‐hoc multiple
comparisons by Bonferroni or Dunns test. The P value of one way Anova or Kruskal‐Wallis
appear in right column.
4.3.4.2 Effects of HFD and LA on glucose and insulin serum levels
Non‐significant changes were observed in serum glucose levels (data not shown) after
LA treatment in comparison with the obese group. In contrast, LA was able to reverse
the effects of HFD in insulin plasma levels (P<0.001). However, caloric restriction
induced also a significant reduction (P<0.05) of insulin plasma levels in comparison with
obese animals but not completely reverse the effects of HFD (Table 2). Insulin sensitivity
was analyzed by measuring the homeostatic model assessment (HOMA) index. As found
in table 2, our data revealed that HOMA index was significantly increase in obese rats
(P<0.001) and LA treatment was able to reduce this index to control values. Moreover,
Capítulo 4.3 Resultados III Chapter 4.3 Results III
314
caloric restriction partially reverses the effects if HFD on insulin sensitivity, but the effect
was significantly lower (P<0.01) than under LA supplementation.
4.3.4.3 Effects of LA on hepatic triglyceride content and liver transaminases serum
levels
HFD produced a very significant increase (P<0.001) on hepatic triglyceride content in
liver compared with control rats (Fig.1). Calorie restriction alone was able to reduced
this increase (‐38±16.3% vs obese group), but LA treatment induced a strongest effect (‐
68±11.3% vs obese group, P<0.001), reversing completely the effects of HFD on the
trygliceride content of the liver (Fig.1.). These data suggested that LA could induced
other mechanism to prevent ectopic fat accumulation. Furthermore, HFD induced a
significant increase (P<0.01) in serum levels of ALT and AST, and this increase was
completely reversed by LA treatment and only partially by calorie restriction, ALT serum
levels were reduced but AST serum levels did not change significantly (Table 2).
Figure 1 Changes in hepatic tryglyceryde content induced by HFD and LA treatment.
Values are mean ± SE. ***P<0.001 vs control group; ###P<0.001 vs obese group; cP<0.001 vs
PFO group according to post‐hoc multiple comparisons by Bonferroni or Dunns test. The P
value of one way Anova or Kruskal‐Wallis appear in up corner.
Chapter 4.3 Results III Capítulo 4.3 Resultados III
4.3.4.4 Effects of LA in liver morphology
As revealed by a histological study, rats fed with a HFD developed macro‐ and
microvesicular steatosis with nuclear displacement, which appears to be reversed by LA
treatment. A micro‐steatosis without nuclear displacement was observed in the PFO
group. On the other hand, inflammatory infiltrates and higher macrophage presence
were observed in obese rats, but not in OLIP and PFO rats (Fig.1A). On the other hand,
an increase in activate stellate and Kupfer cells in livers from obese animals were
detected. Moreover, Sirius Red staining revealed a thickening of vascular walls in obese
and PFO animals, which was completely overturned by LA treatment (Fig.1B).Moreover,
in obese animals an increase of collagen fibers within the hepatocytes was also observed
(Fig.1B).
Chapter 4.3 Results III Capítulo 4.3 Resultados III
Chapter 4.3 Results III Capítulo 4.3 Resultados III
B
20X
40X
2
3
4
5
6
7
8
9
10
12
10X
1
CVCV
CV
CV CV
CV
CV
CV CV
CV
CVCV
C
CV
CV
C
CV
C
SDCV
C
CV
CV SD
11
CONTROL OBESE PFOOLIP
Capítulo 4.3 Resultados III Chapter 4.3 Results III
321
Figure 2 Effects of HFD and LA treatment in liver histopathology. (A) Representative
images of H&E‐stained liver sections from different experimental groups; high‐fat‐fed rats
displayed macro (MV) and microvesicular (µV) steatosis with nuclear displacement (Picture
6) and inflammatory infiltrate extended pericellularly in obese rats (Picture 5 lower right
inset). Moreover, increase the presence of active Kupfer (KC) and stellate cells (SC) and
focal hepatocyte necrosis, which were engulfed by macrophages (Picture 6 lower right
inset) increased of diploid hepatocytes (DPC) (Picture 6). PFO rat displayed microvesicular
(µV) steatosis without disturbance of nucleus (Picture 12). (B) Red Sirius staining for
collagen shows a thickening of vascular walls of central veins (CV) and in the space of Disse
(SD) in obese animals (Picture4 and 6). Moreover, an increase in collagen fibers (C) in
hepatic section was also observed in obese group (Picture 11).Thickening of vascular walls
was also observed in PFO rats (Picture 10 and 12).
4.3.4.5 Effects of LA on mRNA levels of several genes involved in lipogenesis, β‐
oxidation, PPARs and PGCs signaling pathways
In order to explore the potential mechanisms involved in the aforementioned effects of
LA on hepatic triglyceride content, the expression of several key enzymes and nuclear
factors involved in lipogenesis and β‐oxidation were evaluated.
A significant increase in Srebp1 (P<0.001) and Dgat2 (P<0.01) mRNA levels were
observed in the obese group in comparison with the control animals. LA was able to
overturn this effect partially (Table 3). Moreover, calorie restriction induced the same
reduction in Srebp1 as LA treatment, although, the reduction induced on the expression
of Dgat2 was smaller than the induced by LA (P<0.05) suggesting that LA is able to
stimulate the expression of this gene by a different mechanism other than calorie
restriction. Interestingly this value was strongly correlated with hepatic triglyceride
content (P<0.001; r=0.6961) (data not shown).
Capítulo 4.3 Resultados III Chapter 4.3 Results III
322
Table 3: Effects of LA on mRNA levels of several genes involved in liver lipogenesis, β‐
oxidation, Ppars and PGCs pathway
CONTROL OBESE OLIP PFO ANOVA
n=10 n=10 n=10 n=6
LIPOGENESIS
Srebp 1.00±0.107 2.50±0.274*** 1.65±0.138#,* 1.72±0.194 0.0002
Dgat2 1.00±0.088 1.51±0.152** 0.89±0.067###, a 1.31±0.0866 0.0008
Β‐OXIDATION
Cpt1 1.00±0.083 0.423±0.075*** 0.992±0.090### 0.843±0.080# 0.0003
Acadl 1.00±0.071 0.69±0.091* 1.28±0.047###, a 0.78±0.029 0.001
Acox1 1.00±0.015 0.36±0.067*** 0.93±0.065###,b 0.62±0.048#,* <0.001
Ppars PATHWAY
Ppar‐α 1.00±0.028 0.62±0.076* 1.85±0.186###,**, a 1.18±0.117# <0.001
Pparγ 1.00±0.044 1.16±0.063 1.95±0.204##,b 1.22±0.075 <0.001
PGCs PATHWAY
Pgc‐1α 1.00±0.029 0.22±0.0.49*** 0.56±0.027##,** 0.47±0.07** 0.0004
Pgc‐1β 1.00±0.038 0.47±0.063*** 1.42±0.111###,c,** 0.82±0.059 <0.001
UNCOUPLING PROTEINS
Ucp2 1.00±0.038 0.66±0.073** 1.13±0.052###,c 0.83±0.035 0.0064
Values are means±SE. *P<0.05, ***P<0.01, ***P<0.001 vs control group; #P<0.05, ##P<0.01,
###P<0.001 vs obese group; aP<0.05 vs PFO group according to post‐hoc multiple
comparisons by Bonferroni or Dunns test. The P value of one way Anova or Kruskal‐Wallis
appear in right column. Gene expression is expressed as fold changes (2‐∆∆CT) compared to
the control group, which was considered as 1.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
323
As expected, rats fed with a HFD showed a marked decrease in Cpt1 (P<0.001), Acadl
(P<0.001) and Acox1 (P<0.05) gene expression, all of them involved in mitochondrial and
peroxisomal β‐oxidation. Similarly as what was observed with lipogenic genes, LA was
able to reverse these effects. Moreover, the effects of LA on Acadl and Acox1 expression
seem to be direct (P<0.05 vs PFO) (Table 3). This values were negatively correlated with
the hepatic triglyceride content (Acadl P=0.0003; r=‐0.6278 and Acox1 P<0.001; r=‐
0.6988) (data not shown).
Furthermore, feeding a HFD induced a significant decrease (P<0.01) in the expression of
Pparα, however, it did not modify the pattern of expression of Pparγ. Nevertheless, LA
treatment induced a significant increase in the expression of Pparα (+86.5%, P<0.001)
and Pparγ (+125.6%, P<0.01), independently of calorie restriction. On the other hand,
HFD produced a significant reduction of Pgc1α (‐76.2%, P<0.001) and Pgc1β (‐45.6%,
P<0.05) gene expression, while LA was able to significantly increase (P<0.01‐P<0.05 vs
OB) the expression of these genes (Table 3). Interestingly, LA treatment induced a
stronger increase (+140.3% vs obese group) than calorie restriction (+46.4% vs obese
group) in Pgc1β expression, this data suggested that LA would be stimulating an
alternative mechanism to regulate the expression of this transcription factor.
4.3.4.6 Effects of LA on several key enzymes of citric acid cycle
The ingestion of a HFD induced a significant impairment (P<0.001) in the activity of
citrate synthase and succinate dehydrogenase in hepatic isolated mitochondria.
Nevertheless, rats fed with a HFD supplemented with LA increased the activity of both
enzymes (P<0.01 and P<0.001 respectively) and these stimulatory effects were
independent of the calorie restriction, suggesting a direct role of LA on citric acid cycle
(Fig.3).
Capítulo 4.3 Resultados III Chapter 4.3 Results III
324
Figure 3: Effects of HFD and LA on activities of citrate synthase (A) and succinate
dehydrogenase (B). Values are mean±SE. ***P<0.001 vs control group; ##P<0.01 vs obese
group; aP<0.05 vs PFO group according to post‐hoc multiple comparisons by Bonferroni or
Dunns test. The P value of one way Anova or Kruskal‐Wallis appear in up corner.
4.3.4.7 Effects of LA on OXPHOS activity on liver mitochondria
LA treatment induced a strong inhibitory effect in the activity (‐54.2%, P<0.001 vs
control) of Complex I (Fig.4A) despite consuming a high fat diet. Moreover, the statistical
differences between OLIP and PFO group (P<0.001) could suggest that this inhibitory
effect was independent of the reduction in food intake. On the other hand, HFD induced
a stimulatory effect in the activity of Complex II+III (Fig.4B) (+92.2%, P<0.001) and
Complex IV (Fig.4C) (+103.2 %, P<0.01) of electron transport chain, being these effects
reversed by LA treatment. Moreover, the reduction observed after LA treatment seems
to be direct and not secondary to calorie restriction as suggested from the statistical
differences observed between OLIP and PFO group in Complex II+III (P<0.01) and also in
Complex IV (P<0.05) activities.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
325
Figure 4 Activities of electron transport chain complexes. (A) Complex I; (B) Complex II+III;
(C) Complex IV. Values are mean±SE. *P<0.05, **P<0.01, vs control group; ###P<0.001 vs
obese group; aP<0.05, bP<0.01 vs PFO group according to post‐hoc multiple comparisons by
Bonferroni or Dunns test. The P value of one way Anova or Kruskal‐Wallis appear in up
corner.
4.3.4.8 Actions of LA on ATP production and mitochondrial bioenergetics
Supplementation with LA induced a significant decrease in the activity (‐68.1%, P<0.001
vs obese group) and expression of ATP synthase (P<0.01) (Fig.5A and 5B). Furthermore,
LA treatment was able to directly reduce ATP production (‐31.7%, P<0.05) (Fig.5C). In
fact, this outcome was a direct effect of LA and not secondary to caloric restriction
(P<0.05 vs PFO). Interestingly, ATP production was positively correlated to energy
efficiency (Fig.5D). Finally, HFD induced a significant decrease in mRNA expression of
Ucp2 (‐39.3%;P<0.05) that was significantly reversed by LA treatment (+189.5%;
P<0.001). This finding appears as a direct effect of LA and not secondary to energy
restriction (P<0.05 vs PFO) (Table 3).
Capítulo 4.3 Resultados III Chapter 4.3 Results III
326
Figure 5 Changes in ATP synthase activity (A), mRNA levels of ATP5c1 (B), mitochondrial
ATP levels (C) and correlation between liver mitochondrial ATP levels and metabolic
efficiency (D). Values are mean±SE. ***P<0.001, vs control group; #P<0.05, ##P<0.01,
###P<0.001 vs obese group; aP<0.05, bP<0.01 vs PFO group according to post‐hoc multiple
comparisons by Bonferroni or Dunns test. The P value of one way Anova or Kruskal‐Wallis
appear in up corner. r=Pearson correlation coefficient. mRNA level are expressed as fold
changes (2‐∆∆CT) compared to control group considered as 1.
4.3.4.9 Changes in mitochondrial copy number and in mitochondrial mass
The ingestion of HFD induced a reduction in mitochondrial copy number (0.39±0.21 vs
1.0±0.45 in control group; P<0.05), although it stimulated a highly significant increase in
mitochondrial mass (50.4±5.51 vs 35.1±5.52 mg mitochondria protein/g of tissue;
P<0.001). Furthermore, LA treatment was able to reverse the effects of HFD in
mitochondrial copy number (1.57±0.68) and reduced the mitochondrial protein mass as
compared to obese group (40.6±3.99 vs 50.4±5.51 mg mitochondria protein/g of tissue;
P<0.05). The statistical differences (P<0.01) observed between mtDNA levels in OLIP
(1.57±0.68) and PFO group (0.69±0.31) and also in values of mitochondrial mass (P<0.05;
Capítulo 4.3 Resultados III Chapter 4.3 Results III
327
52.6±14.06 mg/g of tissue), suggesting that these effects of lipoic acid are not secondary
to a variation in energy intake.
4.3.5 DISCUSSION
In the present study, we have found that LA prevents ectopic fat storage in the liver when
induced by a long term high‐fat feeding through the modulation of mitochondrial
bioenergetics and lipid metabolism. In addition, LA treatment improved systemic insulin
sensitivity and partially reversed the enhancement of insulin resistance induced by a high
fat diet.
In this context, Park et al (2008) described that LA is able to prevent ectopic fat storage in
the liver of rats fed with a HFD and attributed this effect to a decrease in Srebp1 expression
through the regulation of AMPK (Park et al 2008). In agreement with this study, the
histological and biochemical analysis of our samples showed the same effects of LA in
triglyceride content, although in the genetic analysis, we observed that the effect of lipoic
acid treatment in Srebp1 mRNA levels could be secondary to calorie restriction. In order to
shed some light into the mechanisms of these physiological impairments, the expression
levels of several genes involved in lipogenesis and β‐oxidation were measured, such as:
Dgat2, an enzyme responsible for the final step in triacylglycerol synthesis (Yu et al 2005)
and involved in the development of hepatic steatosis (Millar et al 2006). Interestingly,
lipoic acid inhibited, independently from calorie restriction, the expression of this gene,
which could contribute to explain, at least in part, the lower triglyceride accumulation in
the liver of these animals as indicated by the correlation found between Dgat2 mRNA levels
and hepatic triglyceride content. These data suggested that Dgat2, rather than Srebp1, is a
potential target of LA in the liver under our experimental conditions.
Other mechanisms that could explain the development of fatty liver is the impairment of
mitochondrial β‐oxidation (Browning and Horton 2004). Indeed, in the present study and
according to previous investigations (Perez‐Echarri et al 2009), genes involved in
mitochondrial β‐oxidation were down‐regulated in high‐fat fed rats. Our data showed, for
the first time, that LA treatment reversed completely this inhibition of HFD on Acox1 and
Acadl. Furthermore, lipoic acid induced an overexpression of Acadl gene, an enzyme with a
key role in the regulation of mitochondrial β‐oxidation (Hirschey et al 2010) and in the
development of hepatic steatosis (Zhang et al 2007). Thus, we proposed that another
Capítulo 4.3 Resultados III Chapter 4.3 Results III
328
potential mechanism that could explain the beneficial effects of LA on hepatic triglyceride
content is the genetic modulation of β‐oxidation, mainly through the regulation of Acadl
gene expression. Indeed, Acadl is a specific target of Pparα (Mandard, Muller and Kersten
2004), a key transcriptional factor involved in fatty acid metabolism that is able to decrease
fat accumulation by increasing fatty acid degradation (Reddy and Rao 2006). Supporting
this theory, our results and those from other groups (Butler, Hagen and Moreau 2009,
McCarty, Barroso‐Aranda and Contreras 2009) demonstrate that LA treatment is able to
increase the expression of Pparα. In addition, it is important to note the emerging and
pivotal role of Pgc1β in the prevention of hepatic steatosis (Sonoda et al 2007), as well as
its ability to regulate transcriptional activity of Pparα (Meirhaeghe et al 2003). Thus, and
based on the direct and stimulatory effects on Pgc1β mRNA levels observed after LA
treatment, we suggest that there might be an association between the effects of LA on Pgc‐
1β, Pparα and Acadl in liver.
Besides the accumulation of triglyceride within hepatocytes, other mechanisms are
involved in the development of steatosis. In fact, Day et al (2002) proposed the “two hits”
hypothesis which suggested the central role of insulin resistance and mitochondrial
dysfunction in the evolution of simple steatosis to non alcoholic steatohepatitis (NASH)
(Day 2002a). In fact, the beneficial effects of LA treatment in type II diabetes have been
widely described in several studies (de Oliveira et al 2011, Henriksen, Diamond‐Stanic and
Marchionne 2010, Poh and Goh 2009). Taking into account this information, we measured
the effects of HFD and LA treatment on insulin sensitivity and mitochondrial function,
showing an important improvement of insulin sensitivity after LA treatment, measured by
HOMA index. Following this line, our data showed that LA is able to reverse the effect of
long term high‐fat feeding on Pgc1β gene expression and, even, to stimulate further this
gene, without influence of calorie restriction. Some studies highlight the ability of Pgc1β to
modulate similar pathways to Pgc1α, such as mitochondrial energy homeostasis with the
exception of hepatic gluconeogenesis (Lin et al 2003). Furthermore, Hernández et al (2008)
suggested that Pgc1β have the ability to modulate the insulin resistance through lipolysis,
lipogenesis and mitochondrial biogenesis in the liver (Hernandez and Lin 2009). Therefore,
our data suggested that the effects of LA on Pgc1β could modulate, at least in part, the
preventive effects of this antioxidant on insulin resistance and fatty liver observed in our
study.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
329
The second “hit” proposed by Day et al in the progress of NASH is the development of
mitochondrial dysfunction in the liver (Day 2002b). In order to analyze the effects of HFD
and LA in this hit, we studied different parameters of mitochondrial function. Firstly, we
analyzed the effects of HFD and LA supplementation on the activity of the electron
transport chain (ETC). Indeed, our results demonstrated for the first time that LA reduced
the activity of the main complexes of the electron transport chain in the liver, which, in
turn, leads to a lower efficiency of oxidative phosphorylation (OXPHOS) and therefore,
lowers ATP production. These results contrast with the increase observed in the activity of
Krebs cycle, because this enhancement should increase the electron flow within the
respiratory chain. In fact, the stimulatory effects of LA in the activity of citric acid cycle were
also described in other studies (Sudheesh et al 2009, Sudheesh et al 2010). However, we
suggest that the reduction in energy efficiency could be a compensatory mechanism to
combat the excess of energy provided by the high‐fat diet through the Krebs cycle. In fact,
our data evidence that this reduction in ATP synthesis after LA treatment was strongly
correlated with a decrease in body weight gain and total energy efficiency despite a high‐fat
diet. These associations confirm previous studies where a reduction in energy efficiency
after LA treatment was also demonstrated (Prieto‐Hontoria 2009, Luz, Zemdegs and Amaral
2009). Interestingly, these changes in mitochondrial function were accompanied with an
increase in mitochondrial copy number and a decrease in mitochondrial protein mass.
Several authors associated these parameters with morphological and functional changes in
mitochondrial compartment, mainly characterized by more number and more functional
mitochondrion (Mollica et al 2009, Raffaella et al 2008). Furthermore, the decrease in the
activity of electron transport chain could produce an increase in mitochondrial membrane
potential and an up‐regulation of the expression levels of uncoupling proteins genes, such
as Ucp2 gene, mainly expressed in liver and this could, therefore, contributing to dissipate
this membrane potential and impairing energy production (Dlaskova, Clarke and Porter
2010, Ricquier 2005, Margareto et al 2001). In fact, an increase of Ucp2 gene expression
after lipoic acid supplementation was found. This incresase could be related with the
stimulation of Ppar‐α showed in this study, in accordance with Pecqueur et al (Pecqueur et
al 2001). Consequently, it can be hypothesized that this increase in Ucp2 mRNA levels could
also contribute to the reduction observed in energy efficiency as well as in body weight in
rats fed a high fat diet supplemented with LA. Furthermore, recent data have shown the
Capítulo 4.3 Resultados III Chapter 4.3 Results III
330
ability of LA to induce an uncoupling effect between electron transport chain and ATP
synthesis in isolated rat liver mitochondria (Valdecantos et al 2010).
Following the study of the mitochondrial function and energy homeostasis, Pgc1α (Rodgers
et al 2008, Gerhart‐Hines et al 2007) and Pgc1β (Finck and Kelly 2006, Sonoda et al 2007)
were analyzed in this study. Regarding to the first gene, some studies described that LA is
able to stimulate the expression of Pgc1α in different tissues, such as skeletal muscle
(Wang et al 2010) or hepatocytes (McCarty, Barroso‐Aranda and Contreras 2009). A
stimulatory effect of LA on Pgc1α in the liver of rats fed with a high‐fat diet was observed,
although this effect seems to be secondary to caloric restriction, since no significant
differences were found between the OLIP and PFO groups. On the other hand, the
stimulatory effect of LA on Pgc1β gene expression, independently of food restriction
suggests that this transcription factor, instead of Pgc‐1α, is a direct target of LA in the liver.
In fact, different investigations established the key role of Pgc1β in the transcriptional
control of mitochondrial metabolism and energy homeostasis (Shao et al 2010, Vianna et al
2006). Moreover, a higher ability of Pgc1β in comparison with Pgc1α to regulate
mitochondrial function has been proposed in several studies (Shao et al 2010, Vianna et al
2006), suggesting that LA actions on Pgc1β and not on Pgc1α could contribute, to some
extent, to the energy dissipation observed in liver mitochondria after LA treatment. In fact,
the current results demonstrate that LA was able to prevent the effects of high‐fat diet
ingestion in other metabolic parameters such as body weight gain and fat accumulation,
explained partially by a reduction in calorie intake. Kim et al (2004) (Kim et al 2004)
described the ability of LA to diminish food intake by suppression of hypothalamic AMPK
cascade. Furthermore, it was confirmed that LA treatment is able to reduce energy
efficiency to lower levels than control group as described previously by us and other
authors (Kim and Lee 2005, Prieto‐Hontoria 2009).
Other important component of liver injury is the occurrence of inflammation and
fibrogenesis processes in the liver. Recently, Min et al (2010) described the beneficial
effects of LA treatment (100 mg/kg) on liver fibrosis in an animal model of bile duct ligation
through the activation of plasminogen activation inhibitor (PAI‐1) that could be mediated
by JNK and ERK pathway (Min et al 2010). Moreover, Foo et al (2011) observed that
treatment of cell cultures of hepatic stellate cells (HSC‐T6) with DHLA (6, 25 and 50 µM)
induced an inhibition of activation of these cells, which could be also induced through the
stimulation of JNK and ERK (Foo et al 2011). According to these studies our histological
Capítulo 4.3 Resultados III Chapter 4.3 Results III
331
analysis showed that LA treatment could be prevent inflammation in the liver by the
inactivation of inflammatory cells. Furthermore, LA also prevents the increase of liver
fibrosis induced by high fat feeding.
In summary, this investigation demonstrated the ability of lipoic acid to prevent non‐
alcoholic steatosis induced by a HFD; in three different areas. LA regulated the ectopic fat
storage in the liver through lipogenic and β‐oxidation genes and improved insulin
sensitivity. Finally, the novelty and importance of this study is the finding of how lipoic acid
modulates mitochondrial processes involved in energy homeostasis. Thus, LA induced a
significant decrease in the electron transport chain activity as well as in ATP production,
while, this antioxidant increased the expression of Ucp2. This reduction in mitochondrial
energy efficiency could also explain, at least in part, the beneficial effects of LA not only in
fatty liver but also in preventing excessive body weight gain.
Acknowledgements
This work has been supported by Línea especial “Nutrición, Obesidad y Salud” (University of
Navarra LE/97) and Ministry of Science and Innovation (AGL2006‐04716/ALI and AGL2009‐
10873/ALI). M.P. Valdecantos holds a scholarship from “Instituto de Salud Carlos III” (ISCIII)
(Spanish Ministry of Health). Also CIBER and RETICS networks are gratefully credited.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
332
4.3.6 REFERENCES
Aleardi AM, Benard G, Augereau O, Malgat M, Talbot JC, Mazat JP, Letellier T, Dachary‐
Prigent J, Solaini GC and Rossignol R. (2005). Gradual alteration of mitochondrial
structure and function by beta‐amyloids: importance of membrane viscosity changes,
energy deprivation, reactive oxygen species production, and cytochrome c release. J
Bioenerg Biomembr. 37, 207‐25.
Benard G, Faustin B, Passerieux E, Galinier A, Rocher C, Bellance N, Delage JP, Casteilla L,
Letellier T and Rossignol R. (2006). Physiological diversity of mitochondrial oxidative
phosphorylation. Am J Physiol Cell Physiol. 291, C1172‐82.
Bortolato M, Chen K and Shih JC. (2008). Monoamine oxidase inactivation: from
pathophysiology to therapeutics. Adv Drug Deliv Rev. 60, 1527‐33.
Browning JD and Horton JD. (2004). Molecular mediators of hepatic steatosis and liver
injury. J Clin Invest. 114, 147‐52.
Burt AD, Mutton A and Day CP. (1998). Diagnosis and interpretation of steatosis and
steatohepatitis. Semin Diagn Pathol. 15, 246‐58.
Butler JA, Hagen TM and Moreau R. (2009). Lipoic acid improves hypertriglyceridemia by
stimulating triacylglycerol clearance and downregulating liver triacylglycerol secretion.
Arch Biochem Biophys. 485, 63‐71.
Carmiel‐Haggai M, Cederbaum AI and Nieto N. (2005). A high‐fat diet leads to the
progression of non‐alcoholic fatty liver disease in obese rats. Faseb J. 19, 136‐8.
Chiu HY, Tsao LY and Yang RC. (2009). Heat‐shock response protects peripheral blood
mononuclear cells (PBMCs) from hydrogen peroxide‐induced mitochondrial disturbance.
Cell Stress Chaperones. 14, 207‐17.
Day CP. (2002a). NASH‐related liver failure: one hit too many? Am J Gastroenterol. 97,
1872‐4.
Day CP. (2002b). Pathogenesis of steatohepatitis. Best Pract Res Clin Gastroenterol. 16, 663‐
78.
de Oliveira AM, Rondo PH, Luzia LA, D'Abronzo FH and Illison VK. (2011). The effects of
lipoic acid and alpha‐tocopherol supplementation on the lipid profile and insulin
sensitivity of patients with type 2 diabetes mellitus: A randomized, double‐blind,
placebo‐controlled trial. Diabetes Res Clin Pract.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
333
Dlaskova A, Clarke KJ and Porter RK. (2010). The role of UCP 1 in production of reactive
oxygen species by mitochondria isolated from brown adipose tissue. Biochim Biophys
Acta. 1797, 1470‐6.
Dorta DJ, Pigoso AA, Mingatto FE, Rodrigues T, Prado IM, Helena AF, Uyemura SA, Santos
AC and Curti C. (2005). The interaction of flavonoids with mitochondria: effects on
energetic processes. Chem Biol Interact. 152, 67‐78.
Finck BN and Kelly DP. (2006). PGC‐1 coactivators: inducible regulators of energy
metabolism in health and disease. J Clin Invest. 116, 615‐22.
Foo NP, Lin SH, Lee YH, Wu MJ and Wang YJ. (2011). alpha‐Lipoic acid inhibits liver fibrosis
through the attenuation of ROS‐triggered signaling in hepatic stellate cells activated by
PDGF and TGF‐beta. Toxicology. 282, 39‐46.
Gerhart‐Hines Z, Rodgers JT, Bare O, Lerin C, Kim SH, Mostoslavsky R, Alt FW, Wu Z and
Puigserver P. (2007). Metabolic control of muscle mitochondrial function and fatty acid
oxidation through Sirt1/PGC‐1alpha. EMBO J. 26, 1913‐23.
Henriksen EJ, Diamond‐Stanic MK and Marchionne EM. (2010). Oxidative stress and the
etiology of insulin resistance and type 2 diabetes. Free Radic Biol Med.
Hernandez C and Lin JD. (2009). A sweet path to insulin resistance through PGC‐1beta. Cell
Metab. 9, 215‐6.
Hirschey MD, Shimazu T, Goetzman E, Jing E, Schwer B, Lombard DB, Grueter CA, Harris C,
Biddinger S, Ilkayeva OR, Stevens RD, Li Y, Saha AK, Ruderman NB, Bain JR, Newgard CB,
Farese RV, Jr., Alt FW, Kahn CR and Verdin E. (2010). Sirt3 regulates mitochondrial fatty‐
acid oxidation by reversible enzyme deacetylation. Nature. 464, 121‐5.
Kim MS and Lee KU. (2005). Role of hypothalamic 5'‐AMP‐activated protein kinase in the
regulation of food intake and energy homeostasis. J Mol Med. 83, 514‐20.
Kim MS, Park JY, Namkoong C, Jang PG, Ryu JW, Song HS, Yun JY, Namgoong IS, Ha J, Park
IS, Lee IK, Viollet B, Youn JH, Lee HK and Lee KU. (2004). Anti‐obesity effects of alpha‐
lipoic acid mediated by suppression of hypothalamic AMP‐activated protein kinase. Nat
Med. 10, 727‐33.
Lemasters JJ and Hackenbrock CR. (1976). Continuous measurement and rapid kinetics of
ATP synthesis in rat liver mitochondria, mitoplasts and inner membrane vesicles
determined by firefly‐luciferase luminescence. Eur J Biochem. 67, 1‐10.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
334
Lin J, Tarr PT, Yang R, Rhee J, Puigserver P, Newgard CB and Spiegelman BM. (2003). PGC‐
1beta in the regulation of hepatic glucose and energy metabolism. J Biol Chem. 278,
30843‐8.
Liu D, Gharavi R, Pitta M, Gleichmann M and Mattson MP. (2009). Nicotinamide prevents
NAD+ depletion and protects neurons against excitotoxicity and cerebral ischemia:
NAD+ consumption by Sirt1 may endanger energetically compromised neurons.
Neuromolecular Med. 11, 28‐42.
Luz J, Zemdegs JC and Amaral LS. (2009). Chronic lipoic acid treatment worsens energy
imbalances in streptozotocin‐induced diabetic rats. Diabetes Metab. 35, 137‐42.
Mandard S, Muller M and Kersten S. (2004). Peroxisome proliferator‐activated receptor
alpha target genes. Cell Mol Life Sci. 61, 393‐416.
Margareto J, Larrarte E, Marti A and Martinez JA. (2001). Up‐regulation of a thermogenesis‐
related gene (UCP1) and down‐regulation of Ppargamma and aP2 genes in adipose
tissue: possible features of the antiobesity effects of a beta3‐adrenergic agonist.
Biochem Pharmacol. 61, 1471‐8.
Maritim AC, Sanders RA and Watkins JB, 3rd. (2003). Effects of alpha‐lipoic acid on
biomarkers of oxidative stress in streptozotocin‐induced diabetic rats. J Nutr Biochem.
14, 288‐94.
McCarty MF, Barroso‐Aranda J and Contreras F. (2009). The "rejuvenatory" impact of lipoic
acid on mitochondrial function in aging rats may reflect induction and activation of Ppar‐
gamma coactivator‐1alpha. Med Hypotheses. 72, 29‐33.
Meirhaeghe A, Crowley V, Lenaghan C, Lelliott C, Green K, Stewart A, Hart K, Schinner S,
Sethi JK, Yeo G, Brand MD, Cortright RN, O'Rahilly S, Montague C and Vidal‐Puig AJ.
(2003). Characterization of the human, mouse and rat PGC1 beta (peroxisome‐
proliferator‐activated receptor‐gamma co‐activator 1 beta) gene in vitro and in vivo.
Biochem J. 373, 155‐65.
Millar JS, Stone SJ, Tietge UJ, Tow B, Billheimer JT, Wong JS, Hamilton RL, Farese RV, Jr. and
Rader DJ. (2006). Short‐term overexpression of DGAT1 or DGAT2 increases hepatic
triglyceride but not VLDL triglyceride or apoB production. J Lipid Res. 47, 2297‐305.
Min AK, Kim MK, Seo HY, Kim HS, Jang BK, Hwang JS, Choi HS, Lee KU, Park KG and Lee IK.
(2010). Alpha‐lipoic acid inhibits hepatic PAI‐1 expression and fibrosis by inhibiting the
TGF‐beta signaling pathway. Biochem Biophys Res Commun. 393, 536‐41.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
335
Mollica MP, Lionetti L, Moreno M, Lombardi A, De Lange P, Antonelli A, Lanni A, Cavaliere
G, Barletta A and Goglia F. (2009). 3,5‐diiodo‐l‐thyronine, by modulating mitochondrial
functions, reverses hepatic fat accumulation in rats fed a high‐fat diet. J Hepatol. 51,
363‐70.
Padmalayam I, Hasham S, Saxena U and Pillarisetti S. (2009). Lipoic acid synthase (LASY): a
novel role in inflammation, mitochondrial function, and insulin resistance. Diabetes. 58,
600‐8.
Park KG, Min AK, Koh EH, Kim HS, Kim MO, Park HS, Kim YD, Yoon TS, Jang BK, Hwang JS,
Kim JB, Choi HS, Park JY, Lee IK and Lee KU. (2008). Alpha‐lipoic acid decreases hepatic
lipogenesis through adenosine monophosphate‐activated protein kinase (AMPK)‐
dependent and AMPK‐independent pathways. Hepatology. 48, 1477‐86.
Pecqueur C, Alves‐Guerra MC, Gelly C, Levi‐Meyrueis C, Couplan E, Collins S, Ricquier D,
Bouillaud F and Miroux B. (2001). Uncoupling protein 2, in vivo distribution, induction
upon oxidative stress, and evidence for translational regulation. J Biol Chem. 276, 8705‐
12.
Perez‐Carreras M, Del Hoyo P, Martin MA, Rubio JC, Martin A, Castellano G, Colina F,
Arenas J and Solis‐Herruzo JA. (2003). Defective hepatic mitochondrial respiratory chain
in patients with nonalcoholic steatohepatitis. Hepatology. 38, 999‐1007.
Perez‐Echarri N, Perez‐Matute P, Marcos‐Gomez B, Marti A, Martinez JA and Moreno‐Aliaga
MJ. (2009). Down‐regulation in muscle and liver lipogenic genes: EPA ethyl ester
treatment in lean and overweight (high‐fat‐fed) rats. J Nutr Biochem. 20, 705‐14.
Perez‐Matute P, Marti A, Martinez JA, Fernandez‐Otero MP, Stanhope KL, Havel PJ and
Moreno‐Aliaga MJ. (2007). Conjugated linoleic acid inhibits glucose metabolism, leptin
and adiponectin secretion in primary cultured rat adipocytes. Mol Cell Endocrinol. 268,
50‐8.
Perez‐Matute P, Neville MJ, Tan GD, Frayn KN and Karpe F. (2009). Transcriptional control
of human adipose tissue blood flow. Obesity (Silver Spring). 17, 681‐8.
Pessayre D, Berson A, Fromenty B and Mansouri A. (2001). Mitochondria in steatohepatitis.
Semin Liver Dis. 21, 57‐69.
Poh ZX and Goh KP. (2009). A current update on the use of alpha lipoic acid in the
management of type 2 diabetes mellitus. Endocr Metab Immune Disord Drug Targets. 9,
392‐8.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
336
Prieto‐Hontoria PL, Pérez‐Matute P., Fernández‐Galilea M., Martínez J.A., Moreno‐Aliaga
M.J.. (2009). Lipoic acid prevents body weight gain induced by a high fat diet in rats:
Effects on intestinal sugar transport. Journal of Physiology and Biochemestry. 65, 43‐50.
Raffaella C, Francesca B, Italia F, Marina P, Giovanna L and Susanna I. (2008). Alterations in
hepatic mitochondrial compartment in a model of obesity and insulin resistance. Obesity
(Silver Spring). 16, 958‐64.
Rector RS, Thyfault JP, Uptergrove GM, Morris EM, Naples SP, Borengasser SJ, Mikus CR,
Laye MJ, Laughlin MH, Booth FW and Ibdah JA. (2010). Mitochondrial dysfunction
precedes insulin resistance and hepatic steatosis and contributes to the natural history
of non‐alcoholic fatty liver disease in an obese rodent model. J Hepatol. 52, 727‐36.
Reddy JK and Rao MS. (2006). Lipid metabolism and liver inflammation. II. Fatty liver
disease and fatty acid oxidation. Am J Physiol Gastrointest Liver Physiol. 290, G852‐8.
Reed LJ. (1998). From lipoic acid to multi‐enzyme complexes. Protein Sci. 7, 220‐4.
Rickwood D, Darley‐Usmar VM and Wilson MT 1987. Mitochondria a practical approach. In:
DARLEY‐USMAR, VM, RICKWOOD, D & WILSON, MT (eds.). IRL Press Oxford.
Ricquier D. (2005). Respiration uncoupling and metabolism in the control of energy
expenditure. Proc Nutr Soc. 64, 47‐52.
Robertson G, Leclercq I and Farrell GC. (2001). Nonalcoholic steatosis and steatohepatitis.
II. Cytochrome P‐450 enzymes and oxidative stress. Am J Physiol Gastrointest Liver
Physiol. 281, G1135‐9.
Rodgers JT, Lerin C, Gerhart‐Hines Z and Puigserver P. (2008). Metabolic adaptations
through the PGC‐1 alpha and Sirt1 pathways. FEBS Lett. 582, 46‐53.
Sadi G, Yilmaz O and Guray T. (2008). Effect of vitamin C and lipoic acid on streptozotocin‐
induced diabetes gene expression: mRNA and protein expressions of Cu‐Zn Sod and
catalase. Mol Cell Biochem. 309, 109‐16.
Sanyal AJ, Campbell‐Sargent C, Mirshahi F, Rizzo WB, Contos MJ, Sterling RK, Luketic VA,
Shiffman ML and Clore JN. (2001). Nonalcoholic steatohepatitis: association of insulin
resistance and mitochondrial abnormalities. Gastroenterology. 120, 1183‐92.
Shao D, Liu Y, Liu X, Zhu L, Cui Y, Cui A, Qiao A, Kong X, Chen Q, Gupta N, Fang F and Chang
Y. (2010). PGC‐1 beta‐regulated mitochondrial biogenesis and function in myotubes is
mediated by Nrf1 and ERR alpha. Mitochondrion. 10, 516‐27.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
337
Sonoda J, Mehl IR, Chong LW, Nofsinger RR and Evans RM. (2007). PGC‐1beta controls
mitochondrial metabolism to modulate circadian activity, adaptive thermogenesis, and
hepatic steatosis. Proc Natl Acad Sci U S A. 104, 5223‐8.
Sudheesh NP, Ajith TA, Janardhanan KK and Krishnan CV. (2009). Palladium alpha‐lipoic acid
complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory
complexes I‐IV in the heart of aged rats. Food Chem Toxicol. 47, 2124‐8.
Sudheesh NP, Ajith TA, Janardhanan KK and Krishnan CV. (2010). Effect of POLY‐MVA, a
palladium alpha‐lipoic acid complex formulation against declined mitochondrial
antioxidant status in the myocardium of aged rats. Food Chem Toxicol. 48, 1858‐62.
Terni B, Boada J, Portero‐Otin M, Pamplona R and Ferrer I. (2008). Mitochondrial ATP‐
synthase in the entorhinal cortex is a target of oxidative stress at stages I/II of
Alzheimer's disease pathology. Brain Pathol. 20, 222‐33.
Timmers S, de Vogel‐van den Bosch J, Towler MC, Schaart G, Moonen‐Kornips E, Mensink
RP, Hesselink MK, Hardie DG and Schrauwen P. (2010). Prevention of high‐fat diet‐
induced muscular lipid accumulation in rats by alpha lipoic acid is not mediated by AMPK
activation. J Lipid Res. 51, 352‐9.
Valdecantos MP, Perez‐Matute P, Quintero P and Martinez JA. (2010). Vitamin C,
resveratrol and lipoic acid actions on isolated rat liver mitochondria: all antioxidants but
different. Redox Rep. 15, 207‐16.
Vianna CR, Huntgeburth M, Coppari R, Choi CS, Lin J, Krauss S, Barbatelli G, Tzameli I, Kim
YB, Cinti S, Shulman GI, Spiegelman BM and Lowell BB. (2006). Hypomorphic mutation of
PGC‐1beta causes mitochondrial dysfunction and liver insulin resistance. Cell Metab. 4,
453‐64.
Wang Y, Li X, Guo Y, Chan L and Guan X. (2010). alpha‐Lipoic acid increases energy
expenditure by enhancing adenosine monophosphate‐activated protein kinase‐
peroxisome proliferator‐activated receptor‐gamma coactivator‐1alpha signaling in the
skeletal muscle of aged mice. Metabolism. 59, 967‐76.
Wollin SD, Wang Y, Kubow S and Jones PJ. (2004). Effects of a medium chain triglyceride oil
mixture and alpha‐lipoic acid diet on body composition, antioxidant status, and plasma
lipid levels in the Golden Syrian hamster. J Nutr Biochem. 15, 402‐10.
Yu XX, Murray SF, Pandey SK, Booten SL, Bao D, Song XZ, Kelly S, Chen S, McKay R, Monia BP
and Bhanot S. (2005). Antisense oligonucleotide reduction of DGAT2 expression
improves hepatic steatosis and hyperlipidemia in obese mice. Hepatology. 42, 362‐71.
Capítulo 4.3 Resultados III Chapter 4.3 Results III
338
Zhang D, Liu ZX, Choi CS, Tian L, Kibbey R, Dong J, Cline GW, Wood PA and Shulman GI.
(2007). Mitochondrial dysfunction due to long‐chain Acyl‐CoA dehydrogenase deficiency
causes hepatic steatosis and hepatic insulin resistance. Proc Natl Acad Sci U S A. 104,
17075‐80.
CAPÍTULO 4.4/CHAPTER 4.4
Lipoic acid improves mitochondrial function in non‐
alcoholic steatosis through the stimulation of sirtuin 1
and sirtuin 3
Published in Obesity (Silver Spring) (In press)
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
341
4.4 LIPOIC ACID STIMULATES SIRTUIN 1 AND SIRTUIN 3.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
342
4.4.1 ABSTRACT
Non‐alcoholic steatosis is an important hepatic complication of obesity linked to
mitochondrial dysfunction and oxidative stress. Lipoic acid (LA) has been reported to have
beneficial effects on mitochondrial function and to attenuate oxidative stress. The sirtuin
family has been demonstrated to play an important role in the regulation of mitochondrial
function and in the activation of antioxidant defenses. In this study, we analyzed the
potential protective effect of LA supplementation, via the modulation of mitochondrial
defenses through the sirtuin pathway, against oxidative stress associated with high‐fat
feeding. Wistar rats were fed a standard diet (C, n=10), a high‐fat diet (OB, n=10) and a
high‐fat diet supplemented with LA (OLIP, n=10). A group pair‐fed to the latter group (PFO,
n=6) was also included. LA prevented hepatic triglyceride accumulation (‐68.2%) and liver
oxidative damage (P<0.01) through the inhibition of hydroperoxide production (P<0.001)
and the stimulation of mitochondrial antioxidant defenses. LA treatment up‐regulated
manganese superoxide dismutase (60.6%) and glutathione peroxidase (100.2%) activities,
and increased the GSH:GSSG ratio and Ucp2 mRNA levels (P<0.001‐ P<0.01). Moreover, this
molecule reduced oxidative damage in mitochondrial DNA and increased mitochondrial
copy number (P<0.001‐ P<0.01). LA treatment decreased the acetylation levels of Foxo3a
and Pgc1β (P<0.001‐ P<0.01) through the stimulation of Sirt3 and Sirt1 (P<0.001). In
summary, our results demonstrate that the beneficial effects of LA supplementation on
hepatic steatosis could be mediated by its ability to restore the oxidative balance by
increasing antioxidant defenses through the deacetylation of Foxo3a and Pgc1β by Sirt1
and Sirt3.
Keywords: antioxidant defenses; high‐fat diet; mitochondrial biogenesis; obesity; Foxo3a;
Pgc1β.
Abbreviations: NAFLD, non‐alcoholic fatty liver disease; SS, simple steatosis; NASH, non‐
alcoholic steatohepatitis; ROS, reactive oxygen species; Sod2, manganese superoxide
dismutase; Gpx, glutathione peroxidase; LA, α‐lipoic acid; HFD, high‐fat diet; SIRTs, sirtuins;
Sirt1, sirtuin 1; Sirt3, sirtuin 3; Foxo3a, Forkhead transcription factor ; Parp, poly ADP ribose
polymerase; TG, trygliceryde; MDA, malondialdehyde; GSSG, oxidized glutathione; GSH,
reduced glutathione; mtDNA, mitochondrial DNA; O2*‐, superoxide anion; ETC, electron
transport chain; H2O2, hydroperoxide.
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
343
RESUMEN
La esteatosis no alcohólica es una importante complicación hepática de la obesidad ligada a
la disfunción mitocondrial y al estrés oxidativo. Se han descrito numerosos efectos
beneficiosos del ácido lipoico (AL) sobre la funcionalidad mitocondrial y su capacidad para
atenuar el estrés oxidativo. Se ha demostrado el importante papel de la familia de las
sirtuinas en la regulación de la funcionalidad mitocondrial y la activación de las defensas
antioxidantes. En este estudio se analiza el potencial papel protector de la suplementación
con AL frente al estrés oxidativo en el compartimento hepático mitocondrial inducido por la
ingesta de una dieta alta en grasa, a través de la modulación de las defensas antioxidantes
reguladas por las sirtuinas. Para ello, se alimentaron ratas Wistar con una dieta estándar (C,
n=10), una dieta alta en grasa (OB, n=10) y una dieta alta en grasa suplementada con AL
(OLIP, n=10). Además, se introdujo un grupo pair‐fed respecto al grupo suplementado con
AL (PFO, n=6). El AL previno la acumulación de triglicéridos en el hígado (‐68.2%) y el daño
oxidativo (P<0.01) mediante la inhibición de la producción de H2O2 (P<0.001) y la
estimulación de las defensas antioxidantes mitocondriales. Así, el AL estimuló la actividad
de la Sod2 (60.6%) y de la Gpx (100.2%), además incremento el ratio GSH:GSSG y los niveles
de mRNA de la Ucp2 (P<0.001‐ P<0.01). Además, esta molécula disminuyó el daño oxidativo
en el mtDNA e incremento el número de copias de mtDNA (P<0.001‐ P<0.01). El
tratamiento con AL disminuyó los niveles de acetilación de Foxo3a y de Pgc1β (P<0.001‐
P<0.01), mediante la estimulación de Sirt3 y Sirt1 (P<0.001). En resumen, nuestros
resultados demuestran que los efectos beneficiosos de la suplementación con AL en la
esteatosis hepática no‐alcohólica pueden estar mediados por su capacidad para
restablecen el balance oxidativo mediante un incremento de las defensas antioxidantes a
través de la activación de Foxo3a y de Pgc1β por su desacetilación mediada por la Sirt3 y la
Sirt1.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
344
4.4.2 INTRODUCTION
Non‐alcoholic fatty liver disease (NAFLD) which is also considered the major hepatic
representation of metabolic syndrome is a critical complication of obesity (Sorrentino et al
2010, Milagro, Campion and Martinez 2006). Oxidative stress together with insulin
resistance contributes to the transition from simple steatosis (SS) to non alcoholic
steatohepatitis (NASH) (Pessayre 2007). In this regard, not only is the mitochondrion a
major cellular site involved in energy metabolism, but it is also the main source of reactive
oxygen species (ROS). Furthermore and in order to counterbalance the negative effects of
ROS, mitochondria also contain enzymatic antioxidant defenses, such as manganese
superoxide dismutase (Sod2), glutathione peroxidase (Gpx) and mitochondrial glutathione.
When the balance between mitochondrial ROS generation and the antioxidants defenses
was displace to the pro oxidant side an increase in mitochondrial oxidative stress is
observed, leading to impaired mitochondrial function. Moreover, several studies have
described that impaired mitochondrial function plays a central role in the development of
NASH (Rector et al 2010, Bonda et al 2011, Raffaella et al 2008).
Research into the attenuation or complete suppression of oxidative stress as a means of
combating several diseases has flourished and has become a major challenge in recent
years. Several approaches have been carried out in order to either decrease the high levels
of ROS generated or boost the endogenous levels of antioxidants. α‐Lipoic acid (LA) is a
natural antioxidant synthesized through a reaction catalyzed by lipoic acid synthase within
the mitochondria (Padmalayam et al 2009). Furthermore, LA acts as a cofactor of several
mitochondrial bioenergetic enzymes (Reed 1998) and in several processes of aerobic
metabolism. Apart from its role in the mitochondria, when supplemented in diets LA exerts
beneficial physiological effects such as: attenuation of oxidative stress, prevention of body
weight gain induced by HFD, as well as reduction of energy efficiency (Prieto‐Hontoria
2009, Wollin et al 2004).
The sirtuins (SIRTs) are a conserved family of proteins with NAD+‐dependent deacetylase
activity, distinct form class I and II histone deacetylases (Michan and Sinclair 2007). SIRTs
have been demonstrated to play important roles in many physiological and
pathophysiological situations, including metabolic syndrome, cell survival, aging and calorie
restriction‐mediated longevity through deacetylation of numerous substrates (Haigis and
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
345
Sinclair 2010). Furthermore, the role of sirtuin 1 (Sirt1) in the regulation of mitochondrial
biogenesis and energy homeostasis through the activation of peroxisome proliferator‐
activated receptor gamma coactivator 1‐alpha (Pgc1α) has been widely studied (Caito et al
2010a, Canto et al 2010). Sirtuin 3 (Sirt3), another member of the sirtuin family, which is
expressed in mitochondria, plays a role in regulating in vivo energy homeostasis (Ahn et al
2008). Forkhead transcription factor 3a (Foxo3a) is a substrate of Sirt3 (Jacobs et al 2008,
Sundaresan et al 2009) and in its deacetylated form has been demonstrated to stimulate
several antioxidant defenses (Sundaresan et al 2009, Choi et al 2007).
In the light of the above considerations, we suggest that LA treatment may have protective
effects against the oxidative stress associated with a high‐fat feeding via the modulation of
mitochondrial defenses through the sirtuin pathway. To test this hypothesis,several
parameters of oxidative stress and antioxidant defenses in the mitochondrial hepatic
compartment as well as mitochondrial function and sirtuin pathway in rats fed with high‐fat
diet supplemented with LA were assessed.
4.4.3 MATERIALS AND METHODS
4.4.3.1 Animals and diets
Six‐weeks‐old male Wistar rats (n=36) were obtained from the Centre of Applied
Pharmacology (CIFA, Pamplona, Spain). Animals were housed in cages in a temperature‐
controlled room (22 ±2˚C) with a 12‐hour light‐dark cycle, fed a pelleted chow diet and
given deionizer water ad libitum for an adaptation period of 5 days. After this period, rats
were assigned to 4 experimental groups for 8 weeks. The Control (C) group (n=10), was fed
a standard commercially available (Harlan Tekland Iberica, Barcelona, Spain) diet (4.6% w/w
of energy as lipids),. The obese group (OB) (n=10) was fed ad libitum a high‐fat
commercially available (OpenSource Diets, Research Diets, New Jersey, USA) diet (60% w/w
of energy as lipids); the OLIP (Obese + Lipoic acid) group (n=10) was fed ad libitum a HFD
supplemented with racemic α‐lipoic acid (Sigma Aldrich, St. Louis, Missouri, USA) in a
proportion of 0.25 g LA/100 g of diet, as previously described (Prieto‐Hontoria 2009); the
pair‐fed OLIP group (PFO) (n=6) was fed the same amount of HFD provided to the OLIP
group but without the addition of LA. This group will be used to determine if LA actions are
independent of the LA effect on food intake. Body weight and food intake were recorded
every 2‐3 days. At the end of the experimental period, rats were euthanized and blood and
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
346
tissue samples were immediately collected, frozen in liquid nitrogen and kept at ‐80˚C. All
experimental procedures were performed according to National and Institutional
Guidelines for Animal Care and Use at the University of Navarra.
4.4.3.2 Tissue homogenization procedure and mitochondrial isolation
Livers were quickly excised after the animals had been sacrificed and either frozen in liquid
nitrogen or placed in ice‐cold buffer (250 mM sucrose, 1 mM EDTA and 5 mM NaTES,
pH=7.4). Fresh tissue placed in buffer was used to prepare mitochondrial suspensions
according to the modified method of Rickwood et al with minor modifications (Valdecantos
et al 2010). Antioxidant defenses, total and cleaved poly ADP ribose polymerase (Parp)
protein levels and mitochondrial DNA damage were measured in isolated rat liver
mitochondria. Triglyceride content, lipid peroxidation and protein levels were assayed in
total liver homogenates.
4.4.3.3 Hepatic triglyceride content
To determine the hepatic triglyceride (TG) content, 150 mg of frozen liver were sonicated in
a Branson Sonifier 250 for 40 seconds in 1.5 ml of buffer (150 mM NaCl, 0,1% Triton and 10
mM Tris (pH 8)) at 50˚C. After centrifugation at 12000g for 10 min, the supernatant
obtained was used to measure the TG levels using a COBAS‐Mira analyzer (Roche
Diagnostics, Barcelona, Spain).
4.4.3.4 Lipid peroxidation
Malondialdehyde (MDA) levels were quantified following the controlled reaction with
thiobarbituric acid (TBA). Colorimetric changes were measured in liver homogenates with a
commercial kit (Cayman Chemical, Ann Arbor, Michigan, USA) following the manufacturer’s
instructions with minor modifications and using a Luminoskan Ascent (Thermo Electron
Corporation, Foster City, California, USA). Results were corrected by the amount of tissue in
milligrams.
4.4.3.5 Chemiluminescent measurement of superoxide and hydroperoxide production
Superoxide (O2*‐) and hydroperoxide (H2O2) production was quantified in isolated
mitochondria by measuring the lucigenine‐derived and luminol‐derived chemiluminescence
as described previously (Valdecantos et al 2010).
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
347
4.4.3.6 Measurement of antioxidant defenses
Manganese superoxide dismutase and glutathione peroxidase activities were measured in
isolated rat liver mitochondria using enzymatic colorimetric activity kits (Assay Designs Inc,
Ann Arbor, Michigan, USA) with slight modifications as previously described (Valdecantos et
al 2010). Total reduced (GSH) and oxidized (GSSG) glutathione levels were measured in the
same samples using a colorimetric assay (Assay Designs Inc, Ann Arbor, Michigan, USA). The
ratio between GSH and GSSG was also calculated as a marker of antioxidant status in both
erythrocytes and the hepatic mitochondrial compartment.
4.4.3.7 Mitochondrial oxidative damage estimation
Mitochondrial DNA (mtDNA) oxidative damage was estimated as the ratio of 80‐bp
fragment (260–339 position), compared to a 162‐bp fragment (260–421 position) of the
same sample. For real‐time PCR reactions of both fragments, we used SYBR Green qPCR
Master Mix with ROX as reference dye (Invitrogen, Carlsbad, California, USA) in an ABI
PRISM 7900HT Sequence Detection System (Applied Biosystems, Foster City, California,
USA). The primers used were HVII‐FOR260 (5´‐GCCACTTTCCACACAGACATCATA‐3´), HVII‐
L421 (5´‐AGTGCATACCGCCAAAAGATAAA‐3´) and HVII‐C339 (5´‐
TGTTTAAGTGCTGTGGCCAGA‐3´) from Sigma Aldrich (Sigma Aldrich, St. Louis, Missouri,
USA). Both fragments were amplified in a total volume of 10 μl with 15 ng of total DNA, 5 μl
SYBR Green Mix and 10 μM of HVII‐FOR260 and HVII‐L421 for large fragments and 2.5 μM
HVII‐FOR260 and HVII‐C339 for short fragments. The PCR conditions were 2 min at 50°C,
95°C for 10 min, 40 cycles at 95°C for 15 s and 60°C for 1 min.
4.4.3.8 Real‐time quantitative PCR and mitochondrial copy number
Total RNA was isolated from liver using Trizol® reagent (Invitrogen, Carlsbad, California,
USA) and according to the manufacturer’s instructions. RNA concentrations were
determined by Nanodrop 1000 (Thermo Electron Corporation, Foster City, California, USA).
To avoid contamination with genomic DNA, DNA digestion and inactivation was assessed
using the DNAse kit (Ambion Inc, St. Austin, Texas, USA). Four micrograms of RNA were
transcribed to cDNA using the M‐MLV kit (Invitrogen) following instructions from the
suppliers.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
348
Twelve genes were analyzed (Table 1) using predesigned TaqMan® Assays‐on‐demand
(Applied Biosystems). The reaction conditions were set up according to the manufacturer's
instructions. Amplification and detection of specific products were performed using the ABI
PRISM 7900HT Sequence Detection System (Applied Biosystems). All the samples were
analyzed in duplicate. CT values were generated by the ABI software. Finally, the relative
expression levels of each gene were calculated as foldchange (2‐∆∆CT). Hepatic expression
levels of each gene were normalized by β‐Actin or cyclophilin. The ratio between
mitochondrial encoded gen (Mtco2) and nuclear endogenous gen (18s) was used to
calculate the mitochondrial copy number.
Table 1: Gene name and GenBank accession number used in RT‐qPCR
Gen symbol
GenBank number
Gene name Gene function
Sod2 NM_017051.2 Superoxide Dismutase 2, mitochondrial Antioxidant defenses
Gpx NM_ 030826.3 Glutathione peroxidase 1, hepatic Antioxidant defenses
Ucp2 NM_019354.2 Uncoupling protein 2 Antioxidant defenses
Sirt3 NM_001106313.2 Sirtuin (silent mating type information regulation 2 homologue) 3
NAD+ dependentdeacetylase, mitochondrial
Foxo3a NM_001106395.1 Forkhead box O3a Transcription factor
Ppargc1a NM_031347.1 Peroxisome proliferator‐activated receptor gamma, coactivator 1 alpha ( Pgc1α )
Mitochondrial biogenesis
Ppargc1b NM_176075.2 Peroxisome proliferator‐activated receptor gamma, coactivator 1 beta (Pgc1β)
Mitochondrial biogenesis
Nrf1 NM_001100708.1 Nuclear respiratory factor 1 Mitochondrial biogenesis
Mtco2 MIM_516040 Cytochrome c oxidase subunit 2 Mitochondrial encoded gene
18s X03205.1 Eukaryotic 18S rRNA House Keeping
Actb NM_031144.2 β Actin House Keeping
Ppia NM_175707.3 Peptidylprolyl isomerase (cyclophilin)‐like 3
House Keeping
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
349
4.4.3.9 Western blotting
Total proteins were extracted by treating 100 mg of frozen liver with 500 µl of RIPA buffer
containing proteases inhibitor (Sigma Aldrich) and phosphatase inhibitors (2 mM NaVO3, 1
mM NaF). Samples were sonicated in Branson Sonifier 250 equipment, then were incubated
at 4°C for 30 min and then centrifuged at 12,000 g for 1 hour at 4°C, and the supernatant
was collected for analysis. Mitochondrial proteins were extracted by treating isolated rat
liver mitochondria with lysis buffer (1:1) (20 mM TrisHCl pH 8, 137 mM NaCl, 10% glycerol
and 1% Triton) with proteases and phosphatases inhibitors in same proportion than in RIPA
buffer. Samples were incubated at 4oC for 30 min and then centrifuged at 13,000 g for 15
min, and the supernatant was collected for analysis. Proteins were quantified with the BCA
method (Bio Rad laboratories, Madrid, Spain) according to the supplier´s instructions. Total
proteins were resolved in SDS‐PAGE minigels and electroblotted onto PVDF membranes (GE
Healthcare Europe GmbH, Barcelona, Spain). The membranes were blocked and incubated
with specific antibodies against Parp (Cell Signalling Technology, Boston, Massachusetts,
USA), Sirt1, Sirt3 and Actin (Santa Cruz Biotechnology, Heidelberg, Germany). Secondary
antibody was horseradish peroxidase goat anti‐rabbit IgG‐HRP (Bio Rad Laboratories). The
immunoreactive proteins were detected with enhanced chemiluminescence (Pierce
Biotechnology, Rockford, Illinois, USA). Band intensities were quantified using a GS‐800
calibrated densitometer (Bio Rad Laboratories).
4.4.3.10 Immunoprecipitation
For acetylation analysis, 2 µg of anti‐Foxo3a (Santa Cruz Biotechnology) or anti‐Pgc1β
(Santa Cruz Biotechnology) antibody was added to protein extracts and incubated for 2 h at
4°C. After the addition of 30 μg of protein A/G PLUS‐Agarose (Santa Cruz Biotechnology),
incubation at 4°C with shaking was carried out overnight. The A/G PLUS‐Agarose‐beads
were pelleted by centrifugation at 12,000 g for 2 min at 4°C and washed four times with
RIPA buffer at 4°C to remove non‐adsorbed proteins. After the final wash, protein was
released from the beads by treatment at 95°C for 7 min in sample buffer and
electrophoresed on 10% SDS‐PAGE gels and transfer to PVDF membranes. The membranes
were blocked and incubated with specific antibodies against Foxo3a or Pgc1β (Santa Cruz
Biotechnology) to determine total Foxo3a or Pgc1β and anti‐acetylated Lys (Cell Signalling)
to analyze acetylation of Foxo3a and Pgc1β.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
350
4.4.3.11 Statistical analysis
Data are reported as mean ± S.E. Normal distribution was confirmed by two different
methods, Shapiro‐Wilk and Kolmogorov‐Smirnov. In order to determine the effects of LA
treatment, one way Anova followed by Bonferroni post‐hoc analysis or Kruskal‐Wallis
followed by followed by Dunns post‐hoc analysis were carried out depending on the
distribution of the data. Relationship between variables was analyzed by calculating
Pearson correlation coefficients. All statistical analyses were performed using the GraphPad
Prism 5.0 software (GraphPad Software Inc., San Diego, California, USA). Differences were
considered as statistically significant at P<0.05. Variables analyzed and presented in figures
are unique and will not require a multiple comparison correction.
4.4.4 RESULTS
4.4.4.1 Effects of LA on body and liver weights and hepatic triglyceride content
As expected, an increase in body weight (P<0.001) was observed in rats fed a HFD.
Interestingly, this increase was significantly prevented by LA treatment (P<0.001 vs OB).
Furthermore, HFD increases white adipose tissue accumulation (P<0.001) which was
completely reversed by LA treatment (P<0.001 vs OB) (Table 2). Moreover, HFD produced a
very significant increase (P<0.001) on hepatic triglyceride content in liver compared with
control rats (Table 2). Calorie restriction was also able to reduce this increase (P<0.001 vs
OB), but LA lowering effects were of major magnitude and statistically significance between
the OLIP and the PFO group (P<0.001), suggesting a direct lowering effect of LA on liver
triglyceride content. Furthermore, histological analysis previously reported by our group
demonstrated that LA treatment in these animals was able to prevent the development of
SS induced by a HFD.
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
351
Table 2: Body weight gain, body composition, liver triglyceride content, calorie intake and
feeding efficiency in lean and obese rats.
CONTROL OBESE OLIP PFO ANOVA
n=10 n=10 n=10 n=6
Initial body weight (g) 215.1±20.33 218.1±17.75 214.7±20.80 209.8±9.83 n.s
Body weight gain (g) 166.7±27.04 275.9±18.24***,b 153.7±35.45###,b 200.1±16.81 <0.001
WAT (%) 7.2±1.25 13.3±1.83*** 7.2±1.26###,b 9.4±0.95##,* <0.001
Liver weight (%) 2.48±0.457 2.13±0.284 2.59±0.386 2.13±0.258 0.0386
Liver triglyceride content (%) 3.6±1.19 9.2±0.89***,c 2.5±0.72###,c 5.0±1.3* <0.001
Plasma triglyceride (mg/dl) 69.9±20.26 63.7±12.24a 47.2±6.39# 45.9±8.86 0.0024
Plasma cholesterol (mg/dl) 68.8±7.90 68.4±10.20 66.94±12.58 58.7±6.88 0.2182
HDL cholesterol (mg/dl) 23.7±2.89 19.6±3.09* 26.0±3.28###,c 19.9±1.99* <0.001
LDL cholesterol (mg/dl) 52.7±15.03 51.4±11.28 59.9±12.62 46.1±7.08 n.s.
Values are means ± SE. *P<0.05, **P<0.01, ***P<0.001 vs control group; #P<0.05, ##P<0.01,
###P<0.001 vs obese group; aP<0.05, bP<0.01 vs PFO group according to post‐hoc multiple
comparisons by Bonferroni or Dunns test. The P value of one way Anova or Kruskal‐Wallis
appear in up corner.
4.4.4.2 Effects of LA on lipid peroxidation
As shown in figure 1, HFD induced an important increase in lipid peroxidation in the liver
(P<0.001). This effect was reversed by LA treatment, which induces a lower MDA content in
liver in comparison with the obese group (P<0.01) but also in comparison with control
group (P<0.01). Furthermore, this effect can be directly attributed to LA, because a
significant difference was observed between OLIP and PFO groups (P<0.001).
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
352
Figure 1 Effects of LA on liver oxidative damage and reactive oxygen species. (A)
Malondialdehyde levels; (B) Superoxide production, (C) Hydroperoxyde production. Values
are mean±SE. (n=10‐6). **P<0.01, ***P<0.001 vs control group; ##P<0.01, ###P<0.001 vs
obese group; aP<0.05, bP<0.01, cP<0.001 vs PFO group according to one way Anova followed
by post‐hoc multiple comparisons by Bonferroni test. Abbreviations: MDA,
malondialdehyde; O2‐●, superoxide anion; H2O2, hydroperoxide.
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
353
4.4.4.3 Effects of HFD and LA treatment on reactive oxygen species production in IRLM
Oxidative stress has been described as an imbalance between ROS production and
antioxidant defenses. Taking into account that mitochondria are the main source of ROS
production in cells, we checked the role of mitochondrial oxidative stress in the
development of obesity. We measured the production of superoxide anion (O2*‐) the firstly
reactive oxygen species produced in the mitochondrial electron transport chain (ETC). LA
treatment induced a significant increase in O2*‐ production (P<0.001), with no effects
observed by dietary treatment (Figure 1B). Preliminary results of our group showed that
lipoic acid treatment induced a strong inhibition on Complex I and Complex II+III.
Interestingly, a higher correlation between superoxide production and the activity of
Complex I (r=‐0.6226; P=0.0012) and Complex II+III (r=‐0.5687; P=0.0058) was found
(Valdecantos et al 2009). Surprisingly, the opposite effect was observed on H2O2 production
(Figure 1C). Thus, HFD induced a strong increase in the production of H2O2 that was
completely reversed by LA treatment (P<0.001). The differences observed between OLIP
and PFO group (P<0.001) in H2O2 production suggested that LA may activate other
mechanisms independent of calorie restriction to counteract the increase observed in the
levels of this ROS.
4.4.4.4 LA treatment increased antioxidant defenses on rat liver mitochondria
To gain a better insight into the mechanisms that could explain the effects of LA against
mitochondrial oxidative damage, gene expression and activity of several antioxidant
enzymes were investigated. The analysis of gene expression showed that HFD induced a
reduction in mRNA level of Sod2 (0.6±0.13 fold changes; P<0.01 vs C) that overturned to
control levels after LA treatment (1.2±0.53 fold changes; P<0.001 vs OB). However pair‐fed
rats present the same expression levels as obese animals (0.7±0.11 fold changes; P<0.05 vs
OLIP). Conversely, Gpx gene expression was stimulated by HFD (1.8±0.50 fold changes;
P<0.001 vs C) and this effect was reversed by lipoic acid treatment (1.1±0.34 fold changes;
P<0.01 vs OB) and calorie restriction (1.2±0.22 fold changes). As expected, animals with
liver steatosis exhibited an important decrease in Sod2 (P<0.01) and Gpx (P<0.05) activities
in liver mitochondria (Figure 2A and 2B). Interestingly, LA treatment stimulated the activity
of both enzymes and these effects were not secondary to a reduction of food intake, which
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
354
highlights that LA was able to improve mitochondrial antioxidant defenses by different
mechanisms than calorie restriction.
As for the effects of HFD and LA treatment on non enzymatic antioxidant defenses, HFD
induced a significant decrease in GSH:GSSG ratio in rat liver mitochondria (P<0.05), a robust
marker of antioxidant status. LA treatment (Figure 2C) was able to counteract the decrease
and to increase this ratio to levels even higher than in the control group (P<0.001 vs C, OB
and PFO groups). Moreover, the analysis of mRNA levels of Ucp2, which has an important
role in the regulation of mitochondrial redox status, revealed that animals with liver
steatosis showed lower gene expression levels than the control animals (P<0.05) whereas
LA treatment was able to overturn this effect (Figure 2D). Similarly, as in other antioxidant
defenses this effect did not seem secondary to calorie restriction as statistical differences
between OLIP and PFO groups were found (P<0.05).
Figure 2 Changes on mitochondrial antioxidant defenses in different experimental group.
(n=10‐6). (A) Manganese superoxide dismutase activity, (B) Glutathione peroxidase mRNA
activity, (C) Mitochondrial GSH:GSSG ratio (D) Ucp2 mRNA levels. Values are mean±SE.
*P<0.05, ***P<0.001 vs control group; ##P<0.01, ###P<0.001 vs obese group; aP<0.05,
bP<0.01, cP<0.001 vs PFO group according to one way Anova followed by post‐hoc multiple
comparisons by Bonferroni test.
Chapter 4.4 Results IV Capítulo 4.4 Resultados IV
355
4.4.4.5 Changes on mitochondrial biogenesis induced by LA treatment
Regarding mitochondrial copy number, HFD produced an important reduction (49.6%;
P<0.001) as compared to control animals. Interestingly, lipoic acid reversed the effect of
high fat feeding on mitochondrial biogenesis and also induced a significant increase in the
mitochondrial copy number to levels higher than those observed in the control group
(151.1%; P<0.05) (Figure. 3A). Moreover, a negative correlation between mitochondrial
copy number and mtDNA oxidative damage (r= 0.6052; P<0.001) was found. HFD also down
regulated Pgc1α mRNA levels (P<0.01) and this effect was partially reversed by lipoic acid
although no differences were observed in comparison with the PFO group (Figure 3B). HFD
also induced a reduction in NRF1 gene expression (P<0.05) and lipoic acid was able to
counteract these effect (P<0.01) and, as deduced from statistical differences between
groups, this stimulatory effect was not secondary to changes in food intake.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
356
Figure 3 Effect of LA on mitochondrial biogenesis and mitochondrial DNA damage. (n=10‐6). (A) Mitochondrial copy number, (B) mRNA levels of genes involved in
transcriptional control, (C) mt DNA oxidative damage, (D) Quantification of Parp Western Blot, (E) Wester blot analysis of Parp cleavage. Values are mean±SE. *P<0.05,
**P<0.01, ***P<0.001 vs control group; #P<0.05, ##P<0.01, ###P<0.001 vs obese group; aP<0.05, bP<0.01, cP<0.001 vs PFO group according to one way Anova followed by
post‐hoc multiple comparisons by Bonferroni test. Abbreviations: mtDNA, mitochondrial DNA; Parp, poly ADP ribose polymerase.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
357
4.4.4.6 Effects of LA on mitochondrial DNA oxidative damage and Parp
The aforementioned data suggested that liver steatosis induced a pro‐oxidant state in the
mitochondrial liver compartment. This state may lead to oxidative injury in different
mitochondrial structures such as membrane, proteins of ETC or mtDNA. Taking into account
this hypothesis, we analyzed mtDNA oxidative damage by q‐RTPCR and observed that, as
expected, high fat intake induced oxidative damage in mtDNA (Figure 3C) which was
completely reversed by LA treatment. This protective effect was independent of a
reduction in energy intake, as significant differences between OLIP and PFO group were
found (P<0.001). Moreover, mitochondrial DNA oxidative injury were highly correlated with
H2O2 production (r=0.7523; P<0.001).
Next, we investigated the role of LA on mtDNA repair by the measurement of Parp cleavage
in our experimental animal groups. Obese animals showed highest levels of Parp cleavage
(Figure 3D and 3E). This effect of HFD was reversed in part by calorie restriction and
completely overturned by lipoic acid treatment. These data could suggest that LA
stimulates mtDNA repair by the regulation of Parp cleavage. In fact, a highly significant
correlation between mtDNA damage and Parp cleavage was observed (r=0.6315; P<0.001).
4.4.4.7 Changes on Foxo3a mRNA levels and protein acetylation levels
To determine the potential role of Foxo3a in the stimulating actions of LA on antioxidant
defenses previously described, protein levels and acetylation of Foxo3a were measured. As
observed in figure 4A. HFD induced a significant decrease in gene expression of this
transcription factor. Calorie restriction was able to partially reverse the effect of HFD on
Foxo3a gene expression although it did not reach statistical significance. However, lipoic
acid up regulated the mRNA levels of this gene to levels even higher than those observed in
the control group (Figure 4A). Taking into account that protein acetylation of Foxo3a
inhibits the activity of this transcription factor on stimulation of antioxidant defenses; we
measured the acetylation levels by immunoprecipitation. We found that high fat feeding
animals had higher Foxo3a acetylation levels than the control group (Figure 4B).
Interestingly, lipoic acid treatment return acetylation levels to control values. Moreover,
the Foxo3a acetylation percentage of OLIP animals (51.2±11.63%) was lower than PFO
animals (88.5±14.05%). These data suggest that the regulation of Foxo3a gene expression
and its deacetylation could be mediated by the effects of LA on antioxidant defenses.
Chapter 7 Results IV Capítulo 7 Resultados IV
358
Figure 4 Effects of LA on Foxo3a and Pgc1β mRNA levels and protein acetylation. (n=10‐6). (A) mRNA levels of Foxo3a, (B) Lysine acetylation of Foxo3a expressed in fold
changes vs control group, (C) Inmunoprecipitation and western blot analysis of total and acetylated Foxo3a, (D) mRNA levels of Pgc1β, (B) Lysine acetylation of Pgc1β
expressed in fold changes vs control group, (C) Inmunoprecipitation and western blot analysis of total and acetylated Pgc1β. Values are mean±SE. *P<0.05, **P<0.01,
***P<0.001 vs control group; #P<0.05, ##P<0.01, ###P<0.001 vs obese group; aP<0.05, bP<0.01, cP<0.001 vs PFO group according to one way Anova followed by post‐hoc
multiple comparisons by Bonferroni test. Abbreviations: Foxo3a, Forkhead transcription factor; Pgc1β, Peroxisome proliferator‐activated receptor gamma, coactivator 1 beta.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
359
4.4.4.8 Changes on Pgc1β gene expression and acetylation levels
To determine the potential role of Pgc1β in the previously described stimulating actions of
LA on mitochondrial biogenesis, gene expression and protein acetylation of this co‐activator
were measured. HFD induced a significant decrease in the mRNA levels of this transcription
factor (Figure 4D). LA up regulated the expression of this gene in comparison to both obese
and PFO groups (P<0.001). Some studies propose that protein acetylation of Pgc1β could
modulate its activity. Thus, we measured the acetylation levels by immunoprecipitation. As
was the case with Foxo3a, HFD induced an intensification of acetylation of Pgc1β (Figure
4E) and LA was able to decrease these acetylation levels (P<0.001 vs OB). Furthermore, the
acetylation levels of Pgc1β were negatively associated with protein level of Sirt1 (r=‐0.7559;
P<0.001) as well as mitochondrial copy number (r=‐0.7168; P<0.001).
4.4.4.9 Effects of LA on SIRTs
To determine the role of sirtuins in LA actions on hepatic mitochondrial oxidative status, we
analyzed the mRNA and protein levels of Sirt1 and Sirt3 in our experimental groups.
Regarding to Sirt1, HFD down regulated the mRNA levels of this gene (P<0.01) whereas LA
was able to up regulate the mRNA levels up to control values (Figure 5A). However, this
effect may be due to calorie restriction as deduced from the same values observed in the
PFO group. By contrast, LA induced a strong stimulatory effect on protein level of Sirt1 (6.5
fold; P<0.001 vs C and OB group) whereas dietary patterns (obesity and calorie restriction)
had no effect (Figure 5B and 5C). In addition, a highly significant correlation between
protein levels of Sirt1 and mitochondrial copy number was found (r=0.7800; P<0.001). On
the other hand, and similarly to what was observed with Sirt1, HFD induced a reduction in
Sirt3 gene expression and this effect was completely reversed by LA treatment (P<0.001).
This up regulation was not secondary to calorie restriction as inferred from differences with
PFO group (P<0.05) (Figure. 5D). Furthermore, LA also increases Sirt3 protein levels
(P<0.001) and independently of reduction in food intake (Figure. 5E and 5F). Additionally,
the protein levels of Sirt3 were negatively associated with acetylation of Foxo3a (r=‐0.6108;
P=0.002) suggesting that Sirt3 could stimulate the activity of Foxo3a by deacetylation and,
therefore, could mediate the effects of LA.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
360
Figure 5 Effects of LA on sirtuins pathway. (n=10‐6). (A) Sirt1 mRNA levels, (B) Wester blot
analysis of SIRT 1, (C) Quantification of Sirt1 western blot, (D) Sirt3 mRNA levels, (E) Wester
blot analysis of SIRT 3, (F) Quantification of Sirt3 western blot. Values are mean±SE.
**P<0.01 vs control group; ###P<0.001 vs obese group; aP<0.05, cP<0.001 vs PFO group
according to one way Anova followed by post‐hoc multiple comparisons by Bonferroni test.
Abbreviations: Sirt1, sirtuin 1; Sirt3, sirtuin 3.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
361
4.4.5 DISCUSSION
To our knowledge, this is the first study where the effects of LA on sirtuins have been
studied. We have found that the beneficial effects of LA on fatty liver could be mediated
through its actions on mitochondria and more specifically due to its ability to increase the
antioxidant defenses in this compartment which seems to be due to the increase observed
in Sirt1 and Sirt3 proteins.
NAFLD is now considered the main hepatic manifestation of obesity and metabolic
syndrome (Sorrentino et al 2010, Carmiel‐Haggai, Cederbaum and Nieto 2005, Lewis and
Mohanty 2010). In fact, our data have shown that high fat feeding increased body weight
gain and subsequently induced liver steatosis. Further events in the liver include oxidative
stress and the decrease in antioxidant defenses induced by early mitochondrial dysfunction
(Abdel‐Wahab et al 2002, Gambino, Musso and Cassader 2011). Moreover, some
researchers described the ability of LA, a compound with antioxidant properties, to reverse
the effects of HFD on liver steatosis (Park et al 2011, Huong and Ide 2008). In this context,
our data confirm these protective effects of LA on hepatic triglyceride accumulation in an
animal model of diet induced obesity.
The central role of mammalian sirtuins in the regulation of mitochondrial function and
oxidative stress has been reviewed in detail over recent years (Canto and Auwerx 2009,
Haigis and Sinclair 2010, Bell and Guarente 2011, Caito et al 2010b). In fact, several studies
have proposed that SIRTs are important targets to prevent several disorders involving
mitochondrial dysfunction and an increase in oxidative stress (Bonda et al 2011, Tang
2011). Accordingly, in the present study we observed that the increase in sirtuins 1 and 3
induced after LA treatment was accompanied by an enhancement in mitochondrial copy
number which could be associated with the improvement observed in the antioxidant
status of hepatic mitochondrial compartment and could contribute to the beneficial effects
of LA on fatty liver after the ingestion of a HFD.
Several lines of evidence described that Sirt3 stimulates antioxidant defenses by different
ways (Bao et al 2010, Bell and Guarente 2011). One of the most important mechanisms is
the deacetylation of mammalian Foxo factors that control various biological functions,
including detoxification of reactive oxygen species and repair of DNA damage. Particularly,
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
362
the ability of Foxo3a to stimulate mitochondrial antioxidant defenses such as Sod2 has been
described in different studies (Kops et al 2002, Sundaresan et al 2009). Moreover, Jacobs et
al (2008) suggested that Foxo3a is a mitochondrial protein, whose function could be
regulated through the interaction with Sirt3 in the mitochondria (Jacobs et al 2008). In
agreement with this hypothesis, other research described that activation of Foxo3a through
deacetylation is specifically stimulated in response to oxidative stress stimuli (Brunet 2004).
In this context, our results demonstrate for the first time that acetylation levels of Foxo3a
are strongly increased in steatotic livers whereas LA treatment completely reversed this
effect.
In this sense, some studies have indicated that the full‐length form of Sirt3 is located in the
nucleus whereas a shorter form, that is more active, was found in mitochondria (Cooper et
al 2009). Our data suggest that the increase in Foxo3a acetylation in the obese group could
be mediated by a strong reduction in the shorter‐active form of Sirt3 in these animals.
Moreover, our study demonstrated for the first time that LA treatment is able to induce a
strong stimulation of Sirt3 protein and this stimulatory effect could mediate the increase in
antioxidant defenses through the deacetylation of Foxo3a. In fact, some studies have
described that Sirt3 stimulates mitochondrial antioxidant defenses by the activation of Sod2
through acetylation (Chen et al 2011, Someya and Prolla 2010).
In this context, our data revealed an important decrease in antioxidant defenses in obese
animals in agreement with previous studies (Raffaella et al 2008, Park et al 2011). In such a
situation, LA is highly effective in reducing ROS levels as observed with H2O2 but also in
stimulating other antioxidant systems. Manganese dependent superoxide dismutase, acts
as the first line of defense against ROS production in ETC by catalyzing the dismutation of
superoxide anion to hydroperoxide which is further remove by Gpx (Cheng et al 2002).
Moreover, several studies suggest that one of the main mechanisms by which LA modulates
redox balance is its ability to participate in thiol /disulfide exchange (Choi et al 2007).
Accordingly, our data revealed that LA treatment increases GSH:GSSG ratio. These findings
suggest that deacetylation of Foxo3a could mediate the stimulatory effects of LA on
mitochondrial antioxidant defenses.
Moreover, our data showed that LA treatment is able to reverse the deleterious effect of
HFD in mtDNA oxidative damage, corroborating its beneficial effects on oxidative stress of
hepatic mitochondrion after the ingestion of a high‐fat diet. In this sense, Parp is a nuclear
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
363
and mitochondrial enzyme that exerts numerous functions in the maintenance of DNA
stability to transcriptional regulation (Orsucci, Mancuso and Siciliano 2008). Increase of
oxidative stress activates caspase 3, which inhibits Parp by cleavage into two fragments and
produces damage accumulation in mtDNA (Jarrett and Boulton 2007). Consistently, we
observed that in obese animals, Parp is completely cleaved. However, we found a balance
between cleaved‐inactive and total‐active Parp forms in control and LA treated groups.
Interestingly, levels of mtDNA damage and cleaved ratio of Parp are strongly associated and
support the hypothesis that this enzyme contributes to mtDNA repair.
On the other hand, the stimulatory role of mammalian Sirt1 in mitochondrial biogenesis has
been reviewed in detail over recent years (Canto and Auwerx 2009, Haigis and Sinclair
2010). Accordingly, in the present study we observed a strong activation of Sirt1 protein
levels as a response to LA treatment, which are correlated with an increase of
mitochondrial copy number. Regarding the transcriptional control of mitochondrial
biogenesis, several studies have highlighted the central role of Pgc1α and its activation by
Sirt1 (Canto and Auwerx 2009, Fernandez‐Marcos and Auwerx 2011). Interestingly, we
observed that LA treatment is able to up‐regulate Pgc1α gene expression but this increase
seems to be secondary to calorie restriction, as stated in previous studies (Civitarese et al
2007). However, the stimulatory effect of LA on Pgc1βgene expression, independently of
food restriction, suggests that this transcription factor, instead of Pgc1α, is a direct target of
LA in the liver. In fact, different studies have established the key role of Pgc1βin the
transcriptional control of mitochondrial metabolism and energy homeostasis (Vianna et al
2006). Moreover, a higher ability of PGC1‐β in comparison with PGC1‐α to regulate
mitochondrial function has been proposed in several studies (Shao et al 2010), suggesting
that LA actions on PGC1‐β and not on Pgc1α could contribute, to some extent, to the
increase in mitochondrial biogenesis. Moreover, Kelly et al (2009) reported the ability of
Sirt1 to regulate Pgc1β activity by acetylation (Kelly et al 2009). Confirming this finding, our
data showed a marked correlation between Sirt1 protein levels and Pgc1β acetylation.
Interestingly, Pgc1β acetylation levels were also correlated with mitochondrial copy
number suggesting that the deacetylation of Pgc1β could mediate the increase observed in
mitochondrial biogenesis. Moreover, based on the aforementioned stimulatory effects of
LA, which seem not to be mediated by calorie restriction, we propose that this molecule
exerts its actions on mitochondrial biogenesis through the stimulation of Sirt1 and
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
364
consequently of deacetylation of Pgc1β. Regarding the effects of HFD and/or LA treatment
in NRF1 expression levels, another transcriptional regulator of mitochondrial biogenesis
(Scarpulla 2006), the pattern of effects was similar to those observed with Pgc1β according
to previous investigations.
In summary, our results demonstrate for the first time that the beneficial effects of LA
supplementation on fatty liver resulting from the ingestion of a high‐fat diet and associated
with an obese state, could be mediated, at least in part, by its effects on oxidative status of
hepatic mitochondria. Thus, LA seems to restore the oxidative balance by increasing
antioxidant defenses through the activation of Sirt1 and Sirt3 proteins. More specifically,
Sirt1 seems to induce an increase in the mitochondrial copy number through the
deacetylation of Pgc1β, whereas Sirt3 seems to exert a direct effect on antioxidant
defenses such as Sod2 through Foxo3a deacetylation.
Acknowledgments
We would like to thank Ana Lorente and Veronica Ciaurriz for their technical assistance. We
also thank Paul Miller from the Department of Modern Languages (University of Navarra)
for the English scientific revision of the last revision. This work has been supported by Línea
especial “Nutrición, Obesidad y Salud” (University of Navarra LE/97) and Ministry of Science
and Innovation (AGL2006‐04716/ALI and AGL2009‐10873/ALI). MP. Valdecantos holds a
scholarship from “Instituto de Salud Carlos III” (ISCIII) (Spanish Ministry of Health). Also
CIBER and RETICS networks are gratefully credited.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
365
4.4.6 REFERENCES
Ahn BH, Kim HS, Song S, Lee IH, Liu J, Vassilopoulos A, Deng CX and Finkel T. (2008). A role
for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc Natl Acad
Sci U S A. 105, 14447‐52.
Ballinger SW, Van Houten B, Jin GF, Conklin CA and Godley BF. (1999). Hydrogen peroxide
causes significant mitochondrial DNA damage in human RPE cells. Exp Eye Res. 68, 765‐
72.
Bonda DJ, Lee HG, Camins A, Pallas M, Casadesus G, Smith MA and Zhu X. (2011). The
sirtuin pathway in ageing and Alzheimer disease: mechanistic and therapeutic
considerations. Lancet Neurol. 10, 275‐9.
Brunet A. (2004). [The multiple roles of FOXO transcription factors]. Med Sci (Paris). 20,
856‐9.
Caito S, Hwang JW, Chung S, Yao H, Sundar IK and Rahman I. (2010). Parp‐1 inhibition does
not restore oxidant‐mediated reduction in Sirt1 activity. Biochem Biophys Res Commun.
392, 264‐70.
Canto C and Auwerx J. (2009). Caloric restriction, Sirt1 and longevity. Trends Endocrinol
Metab. 20, 325‐31.
Canto C, Gerhart‐Hines Z, Feige JN, Lagouge M, Noriega L, Milne JC, Elliott PJ, Puigserver P
and Auwerx J. (2009). AMPK regulates energy expenditure by modulating NAD+
metabolism and Sirt1 activity. Nature. 458, 1056‐60.
Canto C, Jiang LQ, Deshmukh AS, Mataki C, Coste A, Lagouge M, Zierath JR and Auwerx J.
(2010). Interdependence of AMPK and Sirt1 for metabolic adaptation to fasting and
exercise in skeletal muscle. Cell Metab. 11, 213‐9.
Civitarese AE, Carling S, Heilbronn LK, Hulver MH, Ukropcova B, Deutsch WA, Smith SR and
Ravussin E. (2007). Calorie restriction increases muscle mitochondrial biogenesis in
healthy humans. PLoS Med. 4, e76.
Cooper HM, Huang JY, Verdin E and Spelbrink JN. (2009). A new splice variant of the mouse
Sirt3 gene encodes the mitochondrial precursor protein. PLoS One. 4, e4986.
Chen Y, Zhang J, Lin Y, Lei Q, Guan KL, Zhao S and Xiong Y. (2011). Tumour suppressor Sirt3
deacetylates and activates manganese superoxide dismutase to scavenge ROS. EMBO
Rep. 12, 534‐41.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
366
Cheng CY, Mo M, Grima J, Saso L, Tita B, Mruk D and Silvestrini B. (2002). Indazole
carboxylic acids in male contraception. Contraception. 65, 265‐8.
Choi CS, Savage DB, Kulkarni A, Yu XX, Liu ZX, Morino K, Kim S, Distefano A, Samuel VT,
Neschen S, Zhang D, Wang A, Zhang XM, Kahn M, Cline GW, Pandey SK, Geisler JG,
Bhanot S, Monia BP and Shulman GI. (2007). Suppression of diacylglycerol
acyltransferase‐2 (DGAT2), but not DGAT1, with antisense oligonucleotides reverses
diet‐induced hepatic steatosis and insulin resistance. J Biol Chem. 282, 22678‐88.
Fernandez‐Marcos PJ and Auwerx J. (2011). Regulation of PGC‐1alpha, a nodal regulator of
mitochondrial biogenesis. Am J Clin Nutr. 93, 884S‐90.
Haigis MC and Sinclair DA. (2010). Mammalian sirtuins: biological insights and disease
relevance. Annu Rev Pathol. 5, 253‐95.
Jacobs KM, Pennington JD, Bisht KS, Aykin‐Burns N, Kim HS, Mishra M, Sun L, Nguyen P, Ahn
BH, Leclerc J, Deng CX, Spitz DR and Gius D. (2008). Sirt3 interacts with the daf‐16
homolog Foxo3a in the mitochondria, as well as increases Foxo3a dependent gene
expression. Int J Biol Sci. 4, 291‐9.
Jarrett SG and Boulton ME. (2007). Poly (ADP‐ribose) polymerase offers protection against
oxidative and alkylation damage to the nuclear and mitochondrial genomes of the
retinal pigment epithelium. Ophthalmic Res. 39, 213‐23.
Kelly TJ, Lerin C, Haas W, Gygi SP and Puigserver P. (2009). GCN5‐mediated transcriptional
control of the metabolic coactivator PGC‐1beta through lysine acetylation. J Biol Chem.
284, 19945‐52.
Kops GJ, Dansen TB, Polderman PE, Saarloos I, Wirtz KW, Coffer PJ, Huang TT, Bos JL,
Medema RH and Burgering BM. (2002). Forkhead transcription factor Foxo3a protects
quiescent cells from oxidative stress. Nature. 419, 316‐21.
Madsen‐Bouterse SA, Zhong Q, Mohammad G, Ho YS and Kowluru RA. (2010). Oxidative
damage of mitochondrial DNA in diabetes and its protection by manganese superoxide
dismutase. Free Radic Res. 44, 313‐21.
Michan S and Sinclair D. (2007). Sirtuins in mammals: insights into their biological function.
Biochem J. 404, 1‐13.
Milagro FI, Campion J and Martinez JA. (2006). Weight gain induced by high‐fat feeding
involves increased liver oxidative stress. Obesity (Silver Spring). 14, 1118‐23.
Molnar D, Decsi T and Koletzko B. (2004). Reduced antioxidant status in obese children with
multimetabolic syndrome. Int J Obes Relat Metab Disord. 28, 1197‐202.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
367
Orsucci D, Mancuso M and Siciliano G. (2008). Mitochondria, oxidative stress and Parp‐1
network: a new target for neuroprotective effects of tetracyclines? J Physiol. 586, 2427‐
8.
Padmalayam I, Hasham S, Saxena U and Pillarisetti S. (2009). Lipoic acid synthase (LASY): a
novel role in inflammation, mitochondrial function, and insulin resistance. Diabetes. 58,
600‐8.
Park HJ, DiNatale DA, Chung MY, Park YK, Lee JY, Koo SI, O'Connor M, Manautou JE and
Bruno RS. (2011). Green tea extract attenuates hepatic steatosis by decreasing adipose
lipogenesis and enhancing hepatic antioxidant defenses in ob/ob mice. J Nutr Biochem.
22, 393‐400.
Pessayre D. (2007). Role of mitochondria in non‐alcoholic fatty liver disease. J Gastroenterol
Hepatol. 22 Suppl 1, S20‐7.
Prieto‐Hontoria PL, Pérez‐Matute P., Fernández‐Galilea M., Martínez J.A., Moreno‐Aliaga
M.J.. (2009). Lipoic acid prevents body weight gain induced by a high fat diet in rats:
Effects on intestinal sugar transport. Journal of Physiology and Biochemestry. 65, 43‐50.
Raffaella C, Francesca B, Italia F, Marina P, Giovanna L and Susanna I. (2008). Alterations in
hepatic mitochondrial compartment in a model of obesity and insulin resistance. Obesity
(Silver Spring). 16, 958‐64.
Rector RS, Thyfault JP, Uptergrove GM, Morris EM, Naples SP, Borengasser SJ, Mikus CR,
Laye MJ, Laughlin MH, Booth FW and Ibdah JA. (2010). Mitochondrial dysfunction
precedes insulin resistance and hepatic steatosis and contributes to the natural history
of non‐alcoholic fatty liver disease in an obese rodent model. J Hepatol. 52, 727‐36.
Reed LJ. (1998). From lipoic acid to multi‐enzyme complexes. Protein Sci. 7, 220‐4.
Scarpulla RC. (2006). Nuclear control of respiratory gene expression in mammalian cells. J
Cell Biochem. 97, 673‐83.
Shao D, Liu Y, Liu X, Zhu L, Cui Y, Cui A, Qiao A, Kong X, Chen Q, Gupta N, Fang F and Chang
Y. (2010). PGC‐1 beta‐regulated mitochondrial biogenesis and function in myotubes is
mediated by Nrf1 and ERR alpha. Mitochondrion. 10, 516‐27.
Someya S and Prolla TA. (2010). Mitochondrial oxidative damage and apoptosis in age‐
related hearing loss. Mech Ageing Dev. 131, 480‐6.
Sorrentino P, Terracciano L, D'Angelo S, Ferbo U, Bracigliano A, Tarantino L, Perrella A,
Perrella O, De Chiara G, Panico L, De Stefano N, Lepore M, Mariolina and Vecchione R.
Capítulo 4.4 Resultados IV Chapter 4.4 Results IV
368
(2010). Oxidative stress and steatosis are cofactors of liver injury in primary biliary
cirrhosis. J Gastroenterol. 45, 1053‐62.
Sundaresan NR, Gupta M, Kim G, Rajamohan SB, Isbatan A and Gupta MP. (2009). Sirt3
blocks the cardiac hypertrophic response by augmenting Foxo3a‐dependent antioxidant
defense mechanisms in mice. J Clin Invest. 119, 2758‐71.
Tang BL. (2011). Sirt1's systemic protective roles and its promise as a target in antiaging
medicine. Transl Res. 157, 276‐84.
Valdecantos MP, Perez‐Matute P and Martinez JA. (2009). [Obesity and oxidative stress:
role of antioxidant supplementation]. Rev Invest Clin. 61, 127‐39.
Valdecantos MP, Perez‐Matute P, Quintero P and Martinez JA. (2010). Vitamin C,
resveratrol and lipoic acid actions on isolated rat liver mitochondria: all antioxidants but
different. Redox Rep. 15, 207‐16.
Vianna CR, Huntgeburth M, Coppari R, Choi CS, Lin J, Krauss S, Barbatelli G, Tzameli I, Kim
YB, Cinti S, Shulman GI, Spiegelman BM and Lowell BB. (2006). Hypomorphic mutation of
PGC‐1beta causes mitochondrial dysfunction and liver insulin resistance. Cell Metab. 4,
453‐64.
Wollin SD, Wang Y, Kubow S and Jones PJ. (2004). Effects of a medium chain triglyceride oil
mixture and alpha‐lipoic acid diet on body composition, antioxidant status, and plasma
lipid levels in the Golden Syrian hamster. J Nutr Biochem. 15, 402‐10.
CAPÍTULO 5/CHAPTER 5
Discusión General /General Discussion
Capítulo 5 Discusión General Chapter 5 General Discussion
371
5.1 DISCUSIÓN GENERAL
La primera parte de este trabajo se interesó en el análisis de los efectos del ácido lipoico, la
vitamina C y el resveratrol en mitocondrias aisladas de hígado de rata con el objetivo de
comprobar su capacidad para modular el estado oxidativo mitocondrial (ROS y defensas
antioxidantes) y su papel en la regulación de otros parámetros de funcionalidad
mitocondrial.
La vitamina C es uno de los antioxidantes más utilizados como suplemento dietético debido
a su capacidad para disminuir y neutralizar ROS tal y como ha sido ampliamente descrito en
la bibliografía (Wilson 2009, Frank et al 2006, Ratnam et al 2006). En este sentido, los datos
obtenidos en nuestro trabajo muestran que el tratamiento de extractos mitocondriales con
vitamina C (30 µM) indujo una disminución significativa en los niveles de O2*‐, lo cual
corrobora estudios previos desarrollados tanto in vitro (Kc, Carcamo and Golde 2005) como
en ratas Wistar con NAFLD inducida por una dieta deficiente en colina suplementada con
este antioxidante (Oliveira et al 2003). Esta disminución puede deberse, al menos en parte,
a la estimulación de la actividad de la Sod2 inducida por el tratamiento con vitamina C, que
induciría una rápida transformación del O2*‐ a H2O2. De acuerdo con estos hallazgos,
investigaciones previas desarrolladas en diferentes modelos animales con un incremento
del estrés oxidativo bien por la presencia de diabetes (Sadi, Yilmaz and Guray 2008) o por la
exposición a cloruro de manganeso (Zhang et al 2010), han mostrado el papel protector de
la vitamina C a través de la regulación de Sod2 (Ahmed et al 2011, Marcil et al 2011,
Yogeeta et al 2006, Devi et al 2007). Otro mecanismo que puede justificar los efectos
beneficiosos observados tras el tratamiento con vitamina C es su capacidad para modular la
producción de H2O2 como han descrito varios autores en modelos in vitro (Ahn, Yun and Oh
2006, Kc, Carcamo and Golde 2005) e in vivo (Ahn et al 2008) y que se confirman en el
presente estudio. Por otro lado, la disminución en la producción de H2O2 puede estar
provocada por la estimulación de la mtGpx observada en los extractos mitocondriales
tratados con este antioxidante.
En relación a las acciones de la vitamina C sobre la respiración mitocondrial los resultados
obtenidos mostraron que el tratamiento con este antioxidante indujo pequeños cambios,
Capítulo 5 Discusión General Chapter 5 General Discussion
372
principalmente un descenso del ratio P/O y por tanto de la fosforilación oxidativa (Hinkle
2005), lo cual sugiere que la acción de la vitamina C a nivel mitocondrial contribuya a
disminuir la eficiencia metabólica como ha sido descrito en modelos animales de obesidad
inducida por la dieta (Campion et al 2008). Por otro lado, el aumento en el RCR observado
puede deberse, al menos en parte a la transformación del ácido ascórbico en
dehidroascórbico aprovechando el mayor flujo electrónico proveniente de la cadena de
transporte, como ya ha sido descrito previamente (Mandl, Szarka and Banhegyi 2009).
En relación al tratamiento con resveratrol, distintas investigaciones han descrito la
capacidad del este antioxidante para prevenir el daño oxidativo en el compartimento
mitocondrial en diferentes modelos animales (Lagouge et al 2006, Robb et al 2008b) así
como en estudios in vitro (Brookins Danz et al 2009, Robb et al 2008a, Rubiolo, Mithieux
and Vega 2008). Uno de los caminos que se han propuesto para explicar el efecto protector
de este antioxidante es su capacidad de disminuir los niveles de ROS (Lu et al 2008, Park
and Lee 2008). Por otro lado, algunos autores han demostrado que el resveratrol confiere
resistencia al estrés oxidativo a través de la una inducción progresiva y especifica en la
expresión génica y actividad de la Sod2 (Robb et al 2008a, Robb et al 2008b). Nuestros
datos mostraron resultados similares a los presentados en estas y otras investigaciones a
tiempos cortos de incubación en los que se observó una disminución en los niveles de O2*‐ y
de H2O2 (Brookins Danz et al 2009, Notas et al 2006). En el caso de la producción de O2*‐, la
disminución puede deberse, al menos en parte, al importante aumento en la actividad Sod2
a ambos tiempos de tratamiento. Estos resultados son similares a los apuntados en
múltiples estudios desarrollados in vivo (Bujanda et al 2008, Kasdallah‐Grissa et al 2007,
Robb et al 2008b) e in vitro (Brookins Danz et al 2009, Cao and Li 2004, Robb et al 2008a,
Rubiolo and Vega 2008).
Por el contrario, no se observó un aumento en la actividad mtGpx por lo que la disminución
de los niveles H2O2 no puede ser explicada por las acciones del antioxidante en esta enzima.
De hecho, nuestros datos revelaron una inhibición de la mtGpx después de 30 minutos de
tratamiento con RSV que no se observó después de 60 minutos de tratamiento con el
antioxidante. De acuerdo con estos resultados publicaciones previas han descrito que el
tratamiento con resveratrol puede tener efectos contrapuestos sobre la actividad de esta
enzima (Bujanda et al 2008, Kasdallah‐Grissa et al 2007, Cao and Li 2004), sugiriendo que
Capítulo 5 Discusión General Chapter 5 General Discussion
373
sus acciones dependen del tejido analizado, la dosis y el periodo de tratamiento. De hecho,
Rubiolo et al (2008), en un estudio llevado a cabo en cultivos primarios de hepatocitos de
rata, observaron cambios en la actividad Gpx únicamente empleando dosis elevadas (75
µM) y tras tiempos largos de tratamiento (48 horas). Sin embargo, este estudio estableció
un incremento de la actividad de la catalasa de forma independiente a la dosis y periodo de
tratamiento (Rubiolo, Mithieux and Vega 2008), lo cual podría explicar la reducción
observada en los niveles de H2O2 tras el tratamiento con RSV.
A pesar de que el papel del resveratrol sobre la función mitocondrial ha sido ampliamente
descrito en la literatura (Gutierrez‐Perez et al 2011, Gogada et al 2011, Zhu et al 2011, Chen
et al 2011), en nuestro modelo experimental el tratamiento con resveratrol indujo menores
cambios sobre los parámetros respiratorios que el resto de los antioxidantes empleados.
Estos resultados pueden deberse a que los estudios previos han sido desarrollados en
animales de experimentación o en cultivos celulares en los que, a diferencia de nuestro
estudio, esta molécula puede modular la expresión y los niveles de proteína así como la
acción de factores de regulación y transcripción. De hecho, muchos de estos estudios
atribuyen las acciones del resveratrol sobre la función mitocondrial a su acción sobre la
Sirt1 y Pgc1α (Beeson, Beeson and Schnellmann 2010, Chen et al 2011). No obstante, el
tratamiento provoco una caída en el consumo de oxígeno en el estado 4 que puede
deberse a su capacidad para insertarse en la membrana la interna mitocondrial
protegiéndola del daño inducido por las ROS como ha sido descrito previamente (Megli and
Sabatini 2003).
El ácido lipoico ha sido definido como el “antioxidante de los antioxidantes” (Packer, Witt
and Tritschler 1995) y su capacidad para disminuir la producción de ROS se ha comprobado
en numerosas investigaciones en modelos in vitro (Jia et al 2007) e in vivo (Shen et al 2008).
En este sentido, nuestros datos mostraron una disminución en la producción de O2*‐, lo
cual se corrobora con estudios llevados a cabo con ácido dihidrolipoico, la forma reducida
del ácido lipoico (Schonheit, Gille and Nohl 1995). A diferencia de lo observado con la
vitamina C y el resveratrol, en el caso del ácido lipoico esta disminución no puede ser
explicada por el aumento de la actividad de la Sod2. Sin embargo, esta inhibición podría
justificarse por diferentes mecanismos asociados a procesos redox implicados en el
mantenimiento del balance del ácido lipoico y el dihidrolipoico, el cual posee una elevada
Capítulo 5 Discusión General Chapter 5 General Discussion
374
capacidad para la neutralización de O2*‐ (Haramaki et al 1997). Por otro lado, diversos
trabajos han descrito la capacidad del ácido lipoico para estimular la actividad de las
principales enzimas antioxidantes (Jia et al 2007, Long et al 2009, Padmalayam et al 2009).
A pesar de estos hallazgos, actualmente se ha establecido que esta molécula puede tener
efectos pro‐oxidantes en función de la concentración, el tiempo de incubación así como el
modelo experimental empleado (Cakatay 2006, Moini, Packer and Saris 2002). De hecho, en
este estudio se muestra que el tratamiento con AL induce un aumento en la producción de
H2O2 comparado con su control, dicho incremento podría deberse a la inhibición de la
mtGpx inducida por el antioxidante. Datos similares han sido descritos anteriormente por
Dicter et al (2002) en similares condiciones experimentales a las empleadas en este trabajo
(Dicter, Madar and Tirosh 2002).
En relación a los efectos del ácido lipoico sobre el funcionamiento de la cadena de
transporte de electrones observamos que de entre los tres antioxidantes empleados era el
que ejercía una acción más intensa en los parámetros respiratorios. Así, nuestros datos
revelaron que el ácido lipoico induce un fuerte desacoplamiento de la cadena de electrones
debido principalmente al aumento en el consumo de oxígeno durante la fase fosforilativa
de la OXPHOS. En efecto, datos similares fueron observados por Schönheit et al (1995) en
mitocondria aisladas de cardiomiocitos de rata tratados con ácido lipoico (Schonheit, Gille
and Nohl 1995). Por otro lado, Morkunaite et al (2003) en condiciones experimentales
similares a las del presente estudio observaron una disminución en el potencial de
membrana inducida por el antioxidante que se asoció al desacoplamiento de la CTE
(Morkunaite‐Haimi et al 2003). Además, al igual que la vitamina C, disminuyó el ratio P/O lo
cual puede estar relacionado con la disminución de la eficiencia metabólica observada en el
estudio in vivo y que se explicara más adelante.
Estos datos muestran que bajo nuestras condiciones experimentales y en mitocondrias
aisladas de hígado la vitamina C y el resveratrol actúan según su naturaleza antioxidante
pero cada uno con diferente magnitud y sin afectar de forma significativa a la respiración
mitocondrial. Sin embargo el ácido lipoico, en las mismas condiciones, se comportó como
una sustancia pro‐oxidante y además mostró su capacidad para modular la actividad de la
cadena de transporte de electrones, incluso a tiempos cortos de tratamiento.
Debido a estos resultados, decidimos comprobar cuál era el comportamiento de esta
molécula sobre el estado antioxidante sistémico y en el compartimento mitocondrial
Capítulo 5 Discusión General Chapter 5 General Discussion
375
hepático en un modelo in vivo en el que se indujeron diferentes variaciones en el balance
antioxidante/pro‐oxidante a través de modificaciones dietéticas.
La capacidad del ácido lipoico como potenciador de las defensas antioxidantes endógenas
ha sido ampliamente descrita en la bibliografía (Long et al 2009, Padmalayam et al 2009).
En este sentido, nuestros resultados confirman el papel estimulador de esta molécula sobre
las defensas antioxidantes a nivel eritrocitario. Así, nuestros datos mostraron como la
suplementación con ácido lipoico inducía un aumento en la actividad de la Sod y la Gpx así
como en el ratio GSH:GSSG en animales sin un aumento del estrés oxidativo como ha sido
previamente descrito en otros modelos animales (Marsh, Laursen and Coombes 2006,
Caylak, Aytekin and Halifeoglu 2008).
Paradójicamente nuestros resultados muestran que los efectos del ácido lipoico sobre las
defensas antioxidantes son mayores cuando se da una situación aumento del estrés
oxidativo previa como puede ser la obesidad inducida por la ingesta de una dieta alta en
grasa (Dhibi et al 2011, Koek, Liedorp and Bast 2011). Estos datos sugieren, que este
antioxidante promueva mecanismos compensatorios frente a un aumento del estrés
oxidativo, lo cual concuerda con la falta de efectos antioxidantes del ácido lipoico
observados en el ensayo in vitro anteriormente descrito en el cual no se generó
previamente un estado pro‐oxidante. De hecho, efectos similares se han descrito para otros
tratamientos dietéticos, como en el caso de la suplementación de la dieta con EPA (Perez‐
Matute et al 2007).
Por otro lado, nuestros datos muestran un aumento importante de los niveles de TBARS y
del daño oxidativo en el mtDNA hepático así como una disminución en las defensas
antioxidantes mitocondriales en los animales obesos. En este sentido, múltiples estudios
han descrito el papel del estrés oxidativo y la disfunción mitocondrial como factores
centrales en la evolución de la NAFLD asociada a obesidad (Perez‐Carreras et al 2003,
Rector et al 2010). Teniendo en cuenta, la silente progresión de la esteatosis a formas
compleja de la NAFLD como la NASH, que además requieren para su diagnóstico de técnicas
invasivas como la biopsia hepática (Cortez‐Pinto and Camilo 2004, Adams and Feldstein
2011) quisimos analizar la relación entre la defensas antioxidantes eritrocitarias y los
diferentes marcadores de daño oxidativo a nivel hepático, especialmente en el
compartimento mitocondrial. Así, nuestros datos revelan la existencia de una estrecha
correlación entre las defensas antioxidantes a nivel eritrocitario y los valores en el
compartimento hepático mitocondrial así como con el daño oxidativo tanto en situaciones
Capítulo 5 Discusión General Chapter 5 General Discussion
376
pro‐oxidantes, como la obesidad, como en situaciones en la que se da un aumento de las
defensas antioxidantes, como en el caso de los animales alimentados con una dieta control
suplementada con AL. En consecuencia, los resultados del presente estudio sugieren la
posibilidad de que el estado antioxidante a nivel eritrocitario sea un buen marcador
mínimamente invasivo para valorar la evolución de la NAFLD.
Tras confirmar que el tratamiento con ácido lipoico aumenta las defensas antioxidantes a
nivel sistémico y que es un buen marcador del estado oxidativo en el hígado, nos
planteamos analizar los efectos de este antioxidante sobre el desarrollo de NAFLD inducida
por una dieta alta en grasa, así como los mecanismos implicados en estos efectos a nivel
mitocondrial.
Para ello en esta parte del estudio empleamos un modelo animal de obesidad inducida por
una dieta alta en grasa. La administración de la dieta hipercalórica indujo un aumento
significativo en la ganancia de peso de las ratas, tal y como había sido descrito
anteriormente (Lira et al 2011, Prieto‐Hontoria 2009). La dosis de ácido lipoico utilizada es
similar a la de otros ensayos en los que también se ha observado la capacidad de este
antioxidante para prevenir o revertir la obesidad y la acumulación de grasa en el hígado en
modelos animales de obesidad (Huong and Ide 2008, Kim et al 2004, Prieto‐Hontoria 2009).
Por otro lado, estudios previos han evidenciado las propiedades anorexígenas del ácido
lipoico a dosis similares a las empleadas en esta investigación (Kim et al 2004, Shen et al
2008, Song et al 2005). Nuestros datos confirmaron que los animales tratados con ácido
lipoico disminuían significativamente su ingesta de alimento, por lo que para poder analizar
si los efectos observados eran secundarios exclusivamente a la restricción calórica se
incluyo en el estudio un grupo pair‐fed con el que fueron comparadas todas las variables
analizadas.
La teoría del “doble impacto” postula que en la evolución de la NAFLD se da un primer
estadio provocado por la acumulación de grasa en el hígado (Day 2002, Day 2006). En este
sentido, algunos estudios han demostrado la capacidad del ácido lipoico para prevenir la
acumulación ectópica de triglicéridos a nivel hepático a través de la activación de diversos
mecanismos (Huong and Ide 2008, Park et al 2008). En el presente estudio se confirma la
capacidad del ácido lipoico para prevenir esta primera fase de la instauración de la NAFLD,
siendo este efecto claramente inducido por el antioxidante y no por la disminución en la
Capítulo 5 Discusión General Chapter 5 General Discussion
377
ingesta. En cuanto a los mecanismos implicados, Park et al (2008) describieron que el
tratamiento con ácido lipoico era capaz de prevenir la acumulación de grasa en el hígado de
ratas alimentadas con una dieta alta en grasa por la disminución en la expresión de Srebp1
modulada a través de la AMPK (Park et al 2008). La disminución de los niveles de mRNA de
Srebp1 también fue observada en nuestro estudio, sin embargo estos niveles eran similares
en el grupo pair‐fed lo que sugiere que esté asociada a la disminución de la ingesta. Sin
embargo, el ácido lipoico fue capaz de disminuir la expresión del gen Dgat2, que está
implicado en la síntesis de triglicéridos (Yu et al 2005) y en el desarrollo de esteatosis
hepática (Millar et al 2006), mientras que en el grupo pair‐fed no se observaron variaciones
significativas en la expresión de este gen.
Por otro lado, la disminución en la expresión de distintos genes implicado en la β‐oxidación
mitocondrial y peroxisomal se ha asociada con el desarrollo de NAFLD (Browning and
Horton 2004, Perez‐Echarri et al 2009). En efecto, nuestros datos muestran que la ingesta
de la dieta alta en grasa induce una disminución en genes implicados en estos procesos
como el Cpt1, Acadl y Acox1. Además, el tratamiento con este antioxidante fue capaz de
revertir estos efectos sobre los tres genes analizados. Especialmente interesantes son los
efectos observados sobre la expresión de Acadl cuyo papel central en la regulación de la β‐
oxidación mitocondrial y el desarrollo de la NAFLD ha sido descrito en diversos estudios
(Hirschey et al 2010, Zhang et al 2007). De hecho, Hirschey et al (2010) describieron en
ratones Sirt3 ‐/‐ que la desacetilación de Acadl por Sirt3 jugaba un papel fundamental en la
regulación de la oxidación de ácidos grasos durante el ayuno (Hirschey et al 2010). En el
presente trabajo describimos que el ácido lipoico estimula tanto la expresión génica como
los niveles de proteína de la Sirt3 en el hígado y que dicha estimulación no es secundaria a
la disminución en la ingesta. Por otro lado, aunque no se han analizado los niveles de
acetilación de Acadl el aumento en la desacetilación de otras dianas de la Sirt3 como el
factor de transcripción Foxo3a parecen indicar que esta proteína se encuentre desacetilada
y por tanto su actividad esté también aumentada en los animales tratados con ácido
lipoico.
Numerosos estudios han descrito el papel central del Pgc1β en la prevención de la
esteatosis hepática y una disminución en la expresión génica de este factor de transcripción
en animales alimentados con una dieta alta en grasa (Sonoda et al 2007, Meirhaeghe et al
Capítulo 5 Discusión General Chapter 5 General Discussion
378
2003, Hernandez and Lin 2009). De acuerdo con esas investigaciones, nuestros datos
muestran que la ingesta de una dieta alta en grasa redujo los niveles de mRNA del Pgc1β y
que este efecto es revertido por el tratamiento con ácido lipoico. Algunos autores han
propuesto que Pgc1β ejerce su acción mediante la regulación de la actividad transcripcional
de Pparα (Song et al 2010, Sonoda et al 2007), cuyo papel estimulador de la β‐oxidación
mitocondrial está ampliamente descrito en la literatura (Haemmerle et al 2011, Song et al
2010). En este sentido, observamos que el tratamiento con ácido lipoico estimulaba la
expresión de Pparα hasta niveles superiores a los observados en los animales control, en
concordancia con datos recientemente publicados por El Midaouis et al (2011) (El Midaoui
et al 2011).
En cuanto a la regulación de Pgc‐1β, Kelly et al (2009) describieron que su actividad estaba
regulada mediante procesos de desacetilación mediados por Sirt1 (Kelly et al 2009). Por
otra parte, numerosos estudios han descrito en los últimos años el papel central de esta
sirtuina en el control del metabolismo lipídico, fundamentalmente en situaciones de ayuno
(Schug and Li 2011, Buler et al 2011, Ponugoti et al 2010). Nuestros datos muestran que el
efecto del ácido lipoico sobre la expresión de Sirt1 parece deberse a la disminución en la
ingesta. Sin embargo, nuestro estudio describe por primera vez el importante papel
estimulador de este antioxidante sobre los niveles de proteína de Sirt1.
Todos estos datos sugieren que el tratamiento con ácido lipoico es capaz de prevenir la
acumulación ectópica de triglicéridos en el hígado, al menos en parte, mediante la
modulación del metabolismo lipídico hepático a través de la estimulación de la Sirt1 y la
Sirt3.
Por otro lado, la resistencia a la insulina se considera como el factor fisiopatológico
individual más importante en el desarrollo de la esteatosis (Browning and Horton 2004,
Garcia‐Monzon et al 2011, Vanni et al 2010). En este sentido, numerosos estudios
desarrollados en animales (Cummings et al 2010, El Midaoui et al 2011, Kandeil et al 2011)
y en humanos (Lee and Dugoua 2011, de Oliveira et al 2011, Poh and Goh 2009), han
descrito la capacidad de esta molécula de aumentar la sensibilidad a la insulina y disminuir
los niveles plasmáticos de glucosa. De acuerdo con estas investigaciones, nuestros
resultados muestran que la suplementación con ácido lipoico revirtió los efectos de la dieta
alta en grasa sobre la sensibilidad a la insulina, disminuyendo los niveles plasmáticos de
Capítulo 5 Discusión General Chapter 5 General Discussion
379
insulina y el índice HOMA hasta valores control. Sin embargo, la disminución en la ingesta
aunque también mejoró la sensibilidad a la insulina lo hizo con una intensidad menor a lo
observada con el tratamiento con el ácido lipoico.
Una vez determinado que el tratamiento con ácido lipoico era capaz de prevenir la
esteatosis hepática, el siguiente objetivo fue evaluar los efectos de este antioxidante sobre
los principales factores implicados en el “segundo impacto”. Uno de los principales
componentes del daño hepático es el desarrolló de inflamación y fibrosis. En este sentido,
investigaciones recientes han descrito que el tratamiento con ácido lipoico es capaz de
disminuir la fibrosis mediante la activación de PAI‐1 (Min et al 2010). Por otro lado, Foo et
al (2011) observaron que este antioxidante inhibía la activación de células estelares
hepática in vitro (Foo et al 2011). Aunque en el presente estudio no hemos analizado
molecularmente estos fenómenos el análisis histológico mostró, en concordancia con estos
estudios, que el tratamiento con AL disminuía la presencia de células inflamatorias, células
estelares hepáticas y células de Kupfer activas en el tejido hepático. De igual manera,
observamos que prevenía el aumento de fibras de colágeno en torno a las paredes
vasculares y en el parénquima hepático inducido por la dieta alta en grasa.
La evidencia de que la disfunción mitocondrial hepática juega un papel fundamental en la
evolución de la NAFLD está ampliamente descrita en la literatura (Krawczyk, Bonfrate and
Portincasa 2010, Rector et al 2010, Serviddio et al 2011, Sookoian et al 2010), por lo que el
análisis de la función mitocondrial fue el siguiente objetivo de esta investigación. Así,
nuestros datos mostraron por primera vez que el ácido lipoico reduce la actividad de la
mayoría de los complejos de la cadena de transporte de electrones, lo que desembocaba en
una disminución en la eficiencia de la fosforilación oxidativa y en una menor síntesis de
ATP. Estos resultados contrastaron con el efecto estimulador del antioxidante sobre
enzimas fundamentales del Ciclo de Krebs (Succinato deshidrogenasa y citrato sintasa), si
bien esta acción ha sido descrita previamente en diversas investigaciones (Sudheesh et al
2009, Sudheesh et al 2010) y concuerda con el papel de esta molécula como co‐factor de
enzimas esenciales del Ciclo de Krebs (Packer and Cadenas 2011, Patel and Packer 2008).
Estos datos sugieren, que el ácido lipoico induzca una disminución en la eficiencia de la
fosforilación oxidativa, mediante el desacoplamiento en la cadena de transporte de
electrones o un funcionamiento reverso de la ATP sintasa en ausencia del gradiente
Capítulo 5 Discusión General Chapter 5 General Discussion
380
electroquímico, como un mecanismo compensatorio al aumento de grasa y energía
proporcionados por la dieta. De hecho, esta hipótesis esta en concordancia con los datos
aportados en el estudio in vitro, en el que se observó que el ácido lipoico provocó un
desacoplamiento de la cadena de transporte, debido fundamentalmente a la disminución
en el consumo de oxígeno en el estado 3. Además, se observó una disminución en la
eficiencia energética en los animales tratados con ácido lipoico, confirmado datos previos
descritos por Luz et al (2009) (Luz, Zemdegs and Amaral 2009). Por otro lado, se observó un
aumento en los niveles de mRNA de la Ucp2 tras el tratamiento con esta molécula que
están de acuerdo con los datos obtenidos en el estudio in vitro anteriormente descritos.
A continuación nos centramos en el estudio de los efectos de este antioxidante sobre la
biogénesis mitocondrial. Así, nuestros datos muestran que el tratamiento con AL indujo un
aumento en el número de copias de mtDNA y una disminución en la masa mitocondrial. Sin
embargo, la dieta alta en grasa indujo los efectos contrarios, lo que sugiere la aparición de
mega‐mitocondrias menos funcionales en los animales obesos de acuerdo a lo descrito por
numerosos autores (Raffaella et al 2008, Mollica et al 2009).
En relación a la regulación de la biogénesis mitocondrial, es necesario que se dé la
interacción entre el genóma mitocondrial y el nuclear, de hecho, está regulada por
numerosos factores de transcripción y co‐activadores nucleares. En los últimos años,
númerosos autores han resaltado el papel central del Pgc1α y de su activación por Sirt1 en
la regulación de este proceso (Canto and Auwerx 2009, Fernandez‐Marcos and Auwerx
2011). Algunos estudios han descrito que el tratamiento con ácido lipoico es capaz de
estimular la expresión de Pgc1α en diferentes tejidos (Wang et al 2010, McCarty, Barroso‐
Aranda and Contreras 2009). De acuerdo con estas investigaciones observamos que este
antioxidane era capaz de aumentar los niveles de expresión de Pgc1α. Sin embargo, los
datos observados en el grupo OLIP y PFO eran muy similares sugiriendo que los cambios en
los niveles de mRNA de este co‐activador son secundarios a la disminución en la ingesta
como ha sido descrito en estudios previos desarrollados en animales sometidos a
restricción calórica (Civitarese et al 2007).
No obstante y como hemos mencionado anteriormente, en este estudio observamos que el
AL inducía un aumento en la expresión y la desacetilación de Pgc1β que podía estar
mediado por Sirt1. En relación al papel de este co‐activador en la regulación de la
Capítulo 5 Discusión General Chapter 5 General Discussion
381
funcionalidad mitocondrial y la homeostasis energética, este ha sido analizado
profundamente en los últimos años (Gao et al 2011a, Gao et al 2011b, Kelly et al 2009,
Liesa et al 2008, Shao et al 2010, Srivastava et al 2009). De hecho, Shao et al (2010)
propusieron que Pgc1β poseía una mayor capacidad para la estimulación de la biogénesis
mitocondrial que su homólogo el Pgc1α a través de la estimulación de Nrf1 (Shao et al
2010). De acuerdo con este estudio, nuestros datos mostraron que el antioxidante ejercía
sobre la expresión de Nrf1 efectos similares a los observados para Pgc‐1β. Por otro lado, se
estableció una fuerte correlación entre los niveles de mRNA de Pgc1β y el número de
copias de mtDNA. Otro de los factores que ha sido extensamente revisado como
activadores de la biogénesis mitocondrial son las desacetilasas dependientes de NAD+ de la
familia de las sirtuinas, especialmente la Sirt1 (Canto and Auwerx 2009, Haigis and Sinclair
2010). Como se ha descrito previamente en este estudio, nuestros datos mostraron una
activación de la Sirt1 en los animales tratados con ácido lipoico. Todos estos resultados
parecen sugerir que el ácido lipoico estimula la biogénesis mitocondrial a través de la
acetilación de Pgc1β por Sirt1, promoviendo así un aumento en el número de mitocondrias,
lo cual contribuye a corroborar la hipótesis formulada anteriormente acerca de la
estimulación de mecanismos compensatorios al exceso de energía para prevenir la
acumulación de grasa a nivel hepático.
El principal factor responsable del “segundo impacto” en la evolución de la NAFLD es el
estrés oxidativo que desencadena una serie de daños en diferentes componentes celulares
(Koek, Liedorp and Bast 2011, Gambino, Musso and Cassader 2011). En este sentido,
algunos autores han descrito elevados niveles de MDA en animales con NAFLD (Park et al
2011, Caito et al 2010), resultados similares a los observados en nuestros animales
alimentados con una dieta alta en grasa. Asimismo, hemos podido describir que el
tratamiento con AL prevenía el aumento de la peroxidación lipídica asociada al hígado
graso.
Teniendo cuenta que el estrés oxidativo esta caracterizado por un desequilibrio entre la
producción de ROS y las defensas antioxidantes, en primer lugar analizamos la producción
de ROS. Sorprendentemente, observamos que el AL inducía un aumento en la producción
de O2‐● que se debe, al menos en parte, a la disminución en la actividad de los complejos I y
III de la cadena de transporte de electrones como ha sido descrito anteriormente (Brand
Capítulo 5 Discusión General Chapter 5 General Discussion
382
2010, Brand et al 2004). Sin embargo, los efectos de la dieta alta en grasa en la producción
de H2O2 se revirtieron hasta los niveles control en los animales tratados con AL mientras
que el grupo pair‐fed mostró niveles elevados similares a los de los animales obesos. Estos
datos coinciden con los observados en relación a la peroxidación lipídica, encontrándose de
hecho una fuerte correlación entre ambos parámetros.
Teniendo en cuenta estos datos y dado el hecho de que en los animales alimentados con
una dieta alta en grasa existe un aumento del estrés oxidativo, y por tanto, del daño en el
mtDNA quisimos analizar el efecto del ácido lipoico sobre dicho daño oxidativo en el
mtDNA. Así observamos que, como en el caso de la peroxidación lipídica, el ácido lipoico
fue capaz de revertir los efectos del la dieta alta en grasa sobre el daño oxidativo del
mtDNA. Además, encontramos una elevada correlación entre el daño en el mtDNA y la
producción mitocondrial de H2O2, lo cual sugiere que el aumento de esta ROS sea la
responsable del incremento del daño en el mtDNA.
En relación al daño en el mtDNA quisimos estudiar los efectos de la dieta alta en grasa y del
ácido lipoico sobre los mecanismos de reparación del DNA. En este sentido, la enzima Parp
es la principal responsable de la reparación del daño del DNA (Orsucci, Mancuso and
Siciliano 2008). Si bien tradicionalmente se ha descrito su expresión únicamente en el
núcleo, Jarret et al (2007) describieron la presencia de esta enzima a nivel mitocondrial. Al
mismo tiempo, propusieron que el aumento del estrés oxidativo mitocondrial inducía la
activación de la caspasa 3 responsable del procesamiento de Parp en dos fragmentos
inactivos provocando la acumulación del daño oxidativo en el mtDNA (Jarrett and Boulton
2007). Nuestros datos mostraron que en los animales obesos había un predominio de la
forma procesada de Parp mientras que en los animales tratados con ácido lipoico
aumentaban los niveles de la forma sin procesar. Estos datos sugieren, que el ácido lipoico
además de prevenir el daño oxidativo en el mtDNA es capaz de estimular la reparación del
mismo a través de Parp.
Varios estudios han descrito que la dieta alta en grasa induce una disminución en las
defensas antioxidantes hepáticas (Raffaella et al 2008, Park et al 2011), de hecho, los datos
analizados en esta tesis corroboran estos estudios. Es más, nuestros datos demuestran la
capacidad del ácido lipoico para estimular las defensas antioxidantes mitocondriales de
forma independiente a la disminución en la ingesta inducida por el antioxidante.
Capítulo 5 Discusión General Chapter 5 General Discussion
383
En cuanto a los posibles mecanismos por los que el AL ejerce sus acciones estimuladoras
sobre las defensas antioxidantes mitocondriales, se analizó el papel de la familia de los
factores de transcripción Foxo. Este conjunto de factores de transcripción ejercen
numerosas funciones entre las que se incluye la detoxificación de ROS y la reparación del
DNA. En particular, la capacidad del Foxo3a para estimular las defensas antioxidantes
mitocondriales ha sido descrita en varias investigaciones (Kops et al 2002, Sundaresan et al
2009). Además, Jacobs et al (2008) describieron la presencia de este factor de transcripción
en la mitocondria y sugirieron que su actividad estaba regulada por la interacción con la
Sirt3 en la mitocondria (Jacobs et al 2008). De acuerdo con esta hipótesis otras
investigaciones observaron que Foxo3a se activaba especificamente a través de su
desacetilación en respuesta a situaciones de estrés oxidativo (Brunet 2004). En este
contexto, nuestros resultados demuestran que la dieta alta en grasa aumenta los niveles de
acetilación de Foxo3a mientras que el ácido lipoico revierte estos efectos hasta niveles
control.
Por otro lado, nuestros datos muestran por primera vez que el AL es capaz de inducir un
aumento significativo en la expresión y en los niveles de proteína de la Sirt3, mientras que
la dieta alta en grasa disminuía la expresión y aunque no ejercía efectos significativos sobre
los niveles totales de Sirt3, sí que se observó una importante reducción en la isoforma de
27 KDa. En este sentido, varias investigaciones han definido que la Sirt3 posee diferentes
isoformas con varias localizaciones celulares y niveles de actividad (Alhazzazi et al 2011,
Hallows, Albaugh and Denu 2008). Así, la isoforma corta se encuentra principalmente en la
mitocondria y es más activa que la larga (44 KDa) que está presente en el núcleo y es
inactiva (Schwer et al 2002, Cooper et al 2009). Teniendo en cuenta estos datos, nuestros
resultados parecen sugerir que el AL estimula las defensas antioxidantes mitocondriales
mediante la estimulación de la Sirt3 que, a su vez, es responsable de la activación del factor
de transcripción Foxo3a, regulador último de estas defensas.
En resumen, los datos del presente trabajo muestran la capacidad del ácido lipoico para
prevenir la instauración y el desarrollo de la enfermedad hepática no alcohólica asociada a
la ingesta de una dieta alta en grasa modulando la función mitocondrial y el estrés
oxidativo. Así, en un primer estadio de la enfermedad hepática no alcohólica el ácido
Capítulo 5 Discusión General Chapter 5 General Discussion
384
lipoico mejora la sensibilidad a la insulina y previene la acumulación ectópica de grasa
mediante la regulación de genes implicados en el metabolismo lipídico en el higado,
fundamentalmente, aumentando la expresión de genes implicados en la β‐oxidación (Cpt1,
Acadl y Acox1) y disminuyendo los relacionados con la lipogénesis (Srebp1 y Dgat2). Por
otro parte, el ácido lipoico modula la homeostasis energética mitocondrial en el hígado,
induciendo mecanismos compensatorios al exceso de energía y lípidos suministrado en la
dieta. Fundamentalmente, la disminución de la actividad de la cadena de transporte de
electrones y la síntesis de ATP, el aumento en la actividad del Ciclo de Krebs y el incremento
de la biogénesis mitocondrial. Además, este antioxidante disminuyó el estrés y el daño
oxidativo en el compartimento mitocondrial hepático a través de la estimulación de las
defensas antioxidantes mitocondriales.
En este estudio también se ha descrito por primera vez que el ácido lipoico es un potente
activador de la Sirt1 y la Sirt3. Así, nuestros datos sugieren que las acciones preventivas de
este antioxidantes sobre la disfunción mitocondrial y el estrés oxidativo en el
compartimento hepático mitocondrial asociadas a la NAFLD, estén mediadas por la
estimulación de las sirtuinas y la consecuente desacetilación de dos de sus principales
dianas, el Pgc1β y el Foxo3a. En este sentido, serian necesarios experimentos in vitro para
la profundización acerca de los mecanismos implicados en la estimulación de las sirtuinas
por este antioxidante, siendo este uno de los puntos más interesantes de este estudio. En la
misma línea de investigación, se deberían analizar los efectos del ácido lipoico sobre la
desacetilación de otras dianas de las sirtuinas como la Sod2 o el complejo I de la cadena de
transporte de electrones y sus repercusiones en la enfermedad hepática no alcohólica y
otras patologías asociadas a la obesidad.
Capítulo 5 Discusión General Chapter 5 General Discussion
385
5.2 REFERENCIAS BIBLIOGRAFICAS
Adams LA and Feldstein AE. (2011). Non‐invasive diagnosis of nonalcoholic fatty liver and
nonalcoholic steatohepatitis. J Dig Dis. 12, 10‐6.
Ahmed EA, Omar HM, elghaffar S, Ragb SM and Nasser AY. (2011). The antioxidant activity
of vitamin C, DPPD and L‐cysteine against Cisplatin‐induced testicular oxidative damage
in rats. Food Chem Toxicol. 49, 1115‐21.
Ahn BH, Kim HS, Song S, Lee IH, Liu J, Vassilopoulos A, Deng CX and Finkel T. (2008). A role
for the mitochondrial deacetylase Sirt3 in regulating energy homeostasis. Proc Natl Acad
Sci U S A. 105, 14447‐52.
Ahn T, Yun CH and Oh DB. (2006). Tissue‐specific effect of ascorbic acid supplementation on
the expression of cytochrome P450 2E1 and oxidative stress in streptozotocin‐induced
diabetic rats. Toxicol Lett. 166, 27‐36.
Alhazzazi TY, Kamarajan P, Joo N, Huang JY, Verdin E, D'Silva NJ and Kapila YL. (2011).
Sirtuin‐3 (Sirt3), a novel potential therapeutic target for oral cancer. Cancer. 117, 1670‐
8.
Beeson CC, Beeson GC and Schnellmann RG. (2010). A high‐throughput respirometric assay
for mitochondrial biogenesis and toxicity. Anal Biochem. 404, 75‐81.
Brand MD. (2010). The sites and topology of mitochondrial superoxide production. Exp
Gerontol. 45, 466‐72.
Brand MD, Buckingham JA, Esteves TC, Green K, Lambert AJ, Miwa S, Murphy MP, Pakay JL,
Talbot DA and Echtay KS. (2004). Mitochondrial superoxide and aging: uncoupling‐
protein activity and superoxide production. Biochem Soc Symp. 203‐13.
Brookins Danz ED, Skramsted J, Henry N, Bennett JA and Keller RS. (2009). Resveratrol
prevents doxorubicin cardiotoxicity through mitochondrial stabilization and the Sirt1
pathway. Free Radic Biol Med.
Browning JD and Horton JD. (2004). Molecular mediators of hepatic steatosis and liver
injury. J Clin Invest. 114, 147‐52.
Brunet A. (2004). [The multiple roles of FOXO transcription factors]. Med Sci (Paris). 20,
856‐9.
Capítulo 5 Discusión General Chapter 5 General Discussion
386
Bujanda L, Hijona E, Larzabal M, Beraza M, Aldazabal P, Garcia‐Urkia N, Sarasqueta C,
Cosme A, Irastorza B, Gonzalez A and Arenas JI, Jr. (2008). Resveratrol inhibits
nonalcoholic fatty liver disease in rats. BMC Gastroenterol. 8, 40.
Buler M, Aatsinki SM, Skoumal R and Hakkola J. (2011). Energy sensing factors PGC‐1alpha
and Sirt1 modulate PXR expression and function. Biochem Pharmacol.
Caito S, Hwang JW, Chung S, Yao H, Sundar IK and Rahman I. (2010). Parp‐1 inhibition does
not restore oxidant‐mediated reduction in Sirt1 activity. Biochem Biophys Res Commun.
392, 264‐70.
Cakatay U. (2006). Pro‐oxidant actions of alpha‐lipoic acid and dihydrolipoic acid. Med
Hypotheses. 66, 110‐7.
Campion J, Milagro FI, Fernandez D and Martinez JA. (2008). Vitamin C supplementation
influences body fat mass and steroidogenesis‐related genes when fed a high‐fat diet. Int
J Vitam Nutr Res. 78, 87‐95.
Canto C and Auwerx J. (2009). Caloric restriction, Sirt1 and longevity. Trends Endocrinol
Metab. 20, 325‐31.
Cao Z and Li Y. (2004). Potent induction of cellular antioxidants and phase 2 enzymes by
resveratrol in cardiomyocytes: protection against oxidative and electrophilic injury. Eur J
Pharmacol. 489, 39‐48.
Caylak E, Aytekin M and Halifeoglu I. (2008). Antioxidant effects of methionine, alpha‐lipoic
acid, N‐acetylcysteine and homocysteine on lead‐induced oxidative stress to
erythrocytes in rats. Experimental and Toxicologic Pathology. 60, 289‐294.
Civitarese AE, Carling S, Heilbronn LK, Hulver MH, Ukropcova B, Deutsch WA, Smith SR and
Ravussin E. (2007). Calorie restriction increases muscle mitochondrial biogenesis in
healthy humans. PLoS Med. 4, e76.
Cooper HM, Huang JY, Verdin E and Spelbrink JN. (2009). A new splice variant of the mouse
Sirt3 gene encodes the mitochondrial precursor protein. PLoS One. 4, e4986.
Cortez‐Pinto H and Camilo ME. (2004). Non‐alcoholic fatty liver disease/non‐alcoholic
steatohepatitis (NAFLD/NASH): diagnosis and clinical course. Best Pract Res Clin
Gastroenterol. 18, 1089‐104.
Cummings BP, Stanhope KL, Graham JL, Evans JL, Baskin DG, Griffen SC and Havel PJ. (2010).
Dietary fructose accelerates the development of diabetes in UCD‐T2DM rats:
amelioration by the antioxidant, alpha‐lipoic acid. Am J Physiol Regul Integr Comp
Physiol. 298, R1343‐50.
Capítulo 5 Discusión General Chapter 5 General Discussion
387
Chen LL, Zhang HH, Zheng J, Hu X, Kong W, Hu D, Wang SX and Zhang P. (2011). Resveratrol
attenuates high‐fat diet‐induced insulin resistance by influencing skeletal muscle lipid
transport and subsarcolemmal mitochondrial beta‐oxidation. Metabolism‐Clinical and
Experimental. 60, 1598‐1609.
Day CP. (2002). NASH‐related liver failure: one hit too many? Am J Gastroenterol. 97, 1872‐
4.
Day CP. (2006). Non‐alcoholic fatty liver disease: current concepts and management
strategies. Clin Med. 6, 19‐25.
de Oliveira AM, Rondo PH, Luzia LA, D'Abronzo FH and Illison VK. (2011). The effects of
lipoic acid and alpha‐tocopherol supplementation on the lipid profile and insulin
sensitivity of patients with type 2 diabetes mellitus: A randomized, double‐blind,
placebo‐controlled trial. Diabetes Res Clin Pract.
Devi SA, Vani R, Subramanyam MV, Reddy SS and Jeevaratnam K. (2007). Intermittent
hypobaric hypoxia‐induced oxidative stress in rat erythrocytes: protective effects of
vitamin E, vitamin C, and carnitine. Cell Biochem Funct. 25, 221‐31.
Dhibi M, Brahmi F, Mnari A, Houas Z, Chargui I, Bchir L, Gazzah N, Alsaif MA and Hammami
M. (2011). The intake of high fat diet with different trans fatty acid levels differentially
induces oxidative stress and non alcoholic fatty liver disease (NAFLD) in rats. Nutr Metab
(Lond). 8, 65.
Dicter N, Madar Z and Tirosh O. (2002). Alpha‐lipoic acid inhibits glycogen synthesis in rat
soleus muscle via its oxidative activity and the uncoupling of mitochondria. J Nutr. 132,
3001‐6.
El Midaoui A, Lungu C, Wang H, Wu L, Robillard C, Deblois D and Couture R. (2011). Impact
of alpha‐lipoic acid on liver peroxisome proliferator‐activated receptor‐alpha, vascular
remodeling, and oxidative stress in insulin‐resistant rats. Can J Physiol Pharmacol. 89,
743‐51.
Fernandez‐Marcos PJ and Auwerx J. (2011). Regulation of PGC‐1alpha, a nodal regulator of
mitochondrial biogenesis. Am J Clin Nutr. 93, 884S‐90.
Foo NP, Lin SH, Lee YH, Wu MJ and Wang YJ. (2011). alpha‐Lipoic acid inhibits liver fibrosis
through the attenuation of ROS‐triggered signaling in hepatic stellate cells activated by
PDGF and TGF‐beta. Toxicology. 282, 39‐46.
Capítulo 5 Discusión General Chapter 5 General Discussion
388
Frank J, Flaccus A, Schwarz C, Lambert C and Biesalski HK. (2006). Ascorbic acid suppresses
cell death in rat DS‐sarcoma cancer cells induced by 5‐aminolevulinic acid‐based
photodynamic therapy. Free Radic Biol Med. 40, 827‐36.
Gambino R, Musso G and Cassader M. (2011). Redox Balance in the Pathogenesis of
Nonalcoholic Fatty Liver Disease: Mechanisms and Therapeutic Opportunities. Antioxid
Redox Signal.
Gao M, Wang J, Lu N, Fang F, Liu J and Wong CW. (2011a). Mitogen‐activated protein kinase
kinases promote mitochondrial biogenesis in part through inducing peroxisome
proliferator‐activated receptor gamma coactivator‐1beta expression. Biochim Biophys
Acta. 1813, 1239‐44.
Gao M, Wang J, Wang W, Liu J and Wong CW. (2011b). Phosphatidylinositol 3‐kinase affects
mitochondrial function in part through inducing peroxisome proliferator‐activated
receptor gamma coactivator‐1beta expression. Br J Pharmacol. 162, 1000‐8.
Garcia‐Monzon C, Lo Iacono O, Mayoral R, Gonzalez‐Rodriguez A, Miquilena‐Colina ME,
Lozano‐Rodriguez T, Garcia‐Pozo L, Vargas‐Castrillon J, Casado M, Bosca L, Valverde AM
and Martin‐Sanz P. (2011). Hepatic insulin resistance is associated with increased
apoptosis and fibrogenesis in nonalcoholic steatohepatitis and chronic hepatitis C. J
Hepatol. 54, 142‐52.
Gogada R, Prabhu V, Amadori M, Scott R, Hashmi S and Chandra D. (2011). Resveratrol
Induces p53‐independent, X‐linked Inhibitor of Apoptosis Protein (XIAP)‐mediated Bax
Protein Oligomerization on Mitochondria to Initiate Cytochrome c Release and Caspase
Activation. Journal of Biological Chemistry. 286, 28749‐28760.
Gutierrez‐Perez A, Cortes‐Rojo C, Noriega‐Cisneros R, Calderon‐Cortes E, Manzo‐Avalos S,
Clemente‐Guerrero M, Godinez‐Hernandez D, Boldogh I and Saavedra‐Molina A. (2011).
Protective effects of resveratrol on calcium‐induced oxidative stress in rat heart
mitochondria. J Bioenerg Biomembr. 43, 101‐107.
Haemmerle G, Moustafa T, Woelkart G, Buttner S, Schmidt A, van de Weijer T, Hesselink M,
Jaeger D, Kienesberger PC, Zierler K, Schreiber R, Eichmann T, Kolb D, Kotzbeck P,
Schweiger M, Kumari M, Eder S, Schoiswohl G, Wongsiriroj N, Pollak NM, Radner FP,
Preiss‐Landl K, Kolbe T, Rulicke T, Pieske B, Trauner M, Lass A, Zimmermann R, Hoefler G,
Cinti S, Kershaw EE, Schrauwen P, Madeo F, Mayer B and Zechner R. (2011). ATGL‐
mediated fat catabolism regulates cardiac mitochondrial function via PPAR‐alpha and
PGC‐1. Nat Med. 17, 1076‐85.
Capítulo 5 Discusión General Chapter 5 General Discussion
389
Haigis MC and Sinclair DA. (2010). Mammalian sirtuins: biological insights and disease
relevance. Annu Rev Pathol. 5, 253‐95.
Hallows WC, Albaugh BN and Denu JM. (2008). Where in the cell is Sirt3?‐‐functional
localization of an NAD+‐dependent protein deacetylase. Biochem J. 411, e11‐3.
Haramaki N, Han D, Handelman GJ, Tritschler HJ and Packer L. (1997). Cytosolic and
mitochondrial systems for NADH‐ and NADPH‐dependent reduction of alpha‐lipoic acid.
Free Radic Biol Med. 22, 535‐42.
Hernandez C and Lin JD. (2009). A sweet path to insulin resistance through PGC‐1beta. Cell
Metab. 9, 215‐6.
Hinkle PC. (2005). P/O ratios of mitochondrial oxidative phosphorylation. Biochim Biophys
Acta. 1706, 1‐11.
Hirschey MD, Shimazu T, Goetzman E, Jing E, Schwer B, Lombard DB, Grueter CA, Harris C,
Biddinger S, Ilkayeva OR, Stevens RD, Li Y, Saha AK, Ruderman NB, Bain JR, Newgard CB,
Farese RV, Jr., Alt FW, Kahn CR and Verdin E. (2010). Sirt3 regulates mitochondrial fatty‐
acid oxidation by reversible enzyme deacetylation. Nature. 464, 121‐5.
Huong DT and Ide T. (2008). Dietary lipoic acid‐dependent changes in the activity and
mRNA levels of hepatic lipogenic enzymes in rats. Br J Nutr. 100, 79‐87.
Jacobs KM, Pennington JD, Bisht KS, Aykin‐Burns N, Kim HS, Mishra M, Sun L, Nguyen P, Ahn
BH, Leclerc J, Deng CX, Spitz DR and Gius D. (2008). Sirt3 interacts with the daf‐16
homolog Foxo3a in the mitochondria, as well as increases Foxo3a dependent gene
expression. Int J Biol Sci. 4, 291‐9.
Jarrett SG and Boulton ME. (2007). Poly(ADP‐ribose) polymerase offers protection against
oxidative and alkylation damage to the nuclear and mitochondrial genomes of the
retinal pigment epithelium. Ophthalmic Res. 39, 213‐23.
Jia L, Liu Z, Sun L, Miller SS, Ames BN, Cotman CW and Liu J. (2007). Acrolein, a toxicant in
cigarette smoke, causes oxidative damage and mitochondrial dysfunction in RPE cells:
protection by (R)‐alpha‐lipoic acid. Invest Ophthalmol Vis Sci. 48, 339‐48.
Kandeil MA, Amin KA, Hassanin KA, Ali KM and Mohammed ET. (2011). Role of lipoic acid on
insulin resistance and leptin in experimentally diabetic rats. J Diabetes Complications.
25, 31‐8.
Kasdallah‐Grissa A, Mornagui B, Aouani E, Hammami M, El May M, Gharbi N, Kamoun A and
El‐Fazaa S. (2007). Resveratrol, a red wine polyphenol, attenuates ethanol‐induced
oxidative stress in rat liver. Life Sci. 80, 1033‐9.
Capítulo 5 Discusión General Chapter 5 General Discussion
390
Kc S, Carcamo JM and Golde DW. (2005). Vitamin C enters mitochondria via facilitative
glucose transporter 1 (Glut1) and confers mitochondrial protection against oxidative
injury. Faseb J. 19, 1657‐67.
Kelly TJ, Lerin C, Haas W, Gygi SP and Puigserver P. (2009). GCN5‐mediated transcriptional
control of the metabolic coactivator PGC‐1beta through lysine acetylation. J Biol Chem.
284, 19945‐52.
Kim MS, Park JY, Namkoong C, Jang PG, Ryu JW, Song HS, Yun JY, Namgoong IS, Ha J, Park
IS, Lee IK, Viollet B, Youn JH, Lee HK and Lee KU. (2004). Anti‐obesity effects of alpha‐
lipoic acid mediated by suppression of hypothalamic AMP‐activated protein kinase. Nat
Med. 10, 727‐33.
Koek GH, Liedorp PR and Bast A. (2011). The role of oxidative stress in non‐alcoholic
steatohepatitis. Clin Chim Acta. 412, 1297‐305.
Kops GJ, Dansen TB, Polderman PE, Saarloos I, Wirtz KW, Coffer PJ, Huang TT, Bos JL,
Medema RH and Burgering BM. (2002). Forkhead transcription factor Foxo3a protects
quiescent cells from oxidative stress. Nature. 419, 316‐21.
Krawczyk M, Bonfrate L and Portincasa P. (2010). Nonalcoholic fatty liver disease. Best Pract
Res Clin Gastroenterol. 24, 695‐708.
Lagouge M, Argmann C, Gerhart‐Hines Z, Meziane H, Lerin C, Daussin F, Messadeq N, Milne
J, Lambert P, Elliott P, Geny B, Laakso M, Puigserver P and Auwerx J. (2006). Resveratrol
improves mitochondrial function and protects against metabolic disease by activating
Sirt1 and PGC‐1alpha. Cell. 127, 1109‐22.
Lee T and Dugoua JJ. (2011). Nutritional supplements and their effect on glucose control.
Curr Diab Rep. 11, 142‐8.
Liesa M, Borda‐d'Agua B, Medina‐Gomez G, Lelliott CJ, Paz JC, Rojo M, Palacin M, Vidal‐Puig
A and Zorzano A. (2008). Mitochondrial fusion is increased by the nuclear coactivator
PGC‐1beta. PLoS ONE. 3, e3613.
Lira FS, Rosa JC, Dos Santos RV, Venancio DP, Carnier J, Sanches Pde L, do Nascimento CM,
de Piano A, Tock L, Tufik S, de Mello MT, Damaso AR and Oyama LM. (2011). Visceral fat
decreased by long‐term interdisciplinary lifestyle therapy correlated positively with
interleukin‐6 and tumor necrosis factor‐alpha and negatively with adiponectin levels in
obese adolescents. Metabolism. 60, 359‐65.
Capítulo 5 Discusión General Chapter 5 General Discussion
391
Long J, Gao F, Tong L, Cotman CW, Ames BN and Liu J. (2009). Mitochondrial decay in the
brains of old rats: ameliorating effect of alpha‐lipoic acid and acetyl‐L‐carnitine.
Neurochem Res. 34, 755‐63.
Lu C, Bambang IF, Armstrong JS and Whiteman M. (2008). Resveratrol blocks high glucose‐
induced mitochondrial reactive oxygen species production in bovine aortic endothelial
cells: role of phase 2 enzyme induction? Diabetes Obes Metab. 10, 347‐9.
Luz J, Zemdegs JC and Amaral LS. (2009). Chronic lipoic acid treatment worsens energy
imbalances in streptozotocin‐induced diabetic rats. Diabetes Metab. 35, 137‐42.
Mandl J, Szarka A and Banhegyi G. (2009). Vitamin C: update on physiology and
pharmacology. Br J Pharmacol. 157, 1097‐110.
Marcil V, Lavoie JC, Emonnot L, Seidman E and Levy E. (2011). Analysis of the effects of iron
and vitamin C co‐supplementation on oxidative damage, antioxidant response and
inflammation in THP‐1 macrophages. Clin Biochem. 44, 873‐83.
Marsh SA, Laursen PB and Coombes JS. (2006). Effects of antioxidant supplementation and
exercise training on erythrocyte antioxidant enzymes. International Journal for Vitamin
and Nutrition Research. 76, 324‐331.
McCarty MF, Barroso‐Aranda J and Contreras F. (2009). The "rejuvenatory" impact of lipoic
acid on mitochondrial function in aging rats may reflect induction and activation of
PPAR‐gamma coactivator‐1alpha. Med Hypotheses. 72, 29‐33.
Megli FM and Sabatini K. (2003). Respiration state IV‐generated ROS destroy the
mitochondrial bilayer packing order in vitro. An EPR study. FEBS Lett. 550, 185‐189.
Meirhaeghe A, Crowley V, Lenaghan C, Lelliott C, Green K, Stewart A, Hart K, Schinner S,
Sethi JK, Yeo G, Brand MD, Cortright RN, O'Rahilly S, Montague C and Vidal‐Puig AJ.
(2003). Characterization of the human, mouse and rat PGC1 beta (peroxisome‐
proliferator‐activated receptor‐gamma co‐activator 1 beta) gene in vitro and in vivo.
Biochem J. 373, 155‐65.
Millar JS, Stone SJ, Tietge UJ, Tow B, Billheimer JT, Wong JS, Hamilton RL, Farese RV, Jr. and
Rader DJ. (2006). Short‐term overexpression of DGAT1 or DGAT2 increases hepatic
triglyceride but not VLDL triglyceride or apoB production. J Lipid Res. 47, 2297‐305.
Min AK, Kim MK, Seo HY, Kim HS, Jang BK, Hwang JS, Choi HS, Lee KU, Park KG and Lee IK.
(2010). Alpha‐lipoic acid inhibits hepatic PAI‐1 expression and fibrosis by inhibiting the
TGF‐beta signaling pathway. Biochem Biophys Res Commun. 393, 536‐41.
Capítulo 5 Discusión General Chapter 5 General Discussion
392
Moini H, Packer L and Saris NE. (2002). Antioxidant and prooxidant activities of alpha‐lipoic
acid and dihydrolipoic acid. Toxicol Appl Pharmacol. 182, 84‐90.
Mollica MP, Lionetti L, Moreno M, Lombardi A, De Lange P, Antonelli A, Lanni A, Cavaliere
G, Barletta A and Goglia F. (2009). 3,5‐diiodo‐l‐thyronine, by modulating mitochondrial
functions, reverses hepatic fat accumulation in rats fed a high‐fat diet. J Hepatol. 51,
363‐70.
Morkunaite‐Haimi S, Kruglov AG, Teplova VV, Stolze K, Gille L, Nohl H and Saris NE. (2003).
Reactive oxygen species are involved in the stimulation of the mitochondrial
permeability transition by dihydrolipoate. Biochem Pharmacol. 65, 43‐9.
Notas G, Nifli AP, Kampa M, Vercauteren J, Kouroumalis E and Castanas E. (2006).
Resveratrol exerts its antiproliferative effect on HepG2 hepatocellular carcinoma cells,
by inducing cell cycle arrest, and NOS activation. Biochim Biophys Acta. 1760, 1657‐66.
Oliveira CP, Gayotto LC, Tatai C, Della Nina BI, Lima ES, Abdalla DS, Lopasso FP, Laurindo FR
and Carrilho FJ. (2003). Vitamin C and vitamin E in prevention of Nonalcoholic Fatty Liver
Disease (NAFLD) in choline deficient diet fed rats. Nutr J. 2, 9.
Orsucci D, Mancuso M and Siciliano G. (2008). Mitochondria, oxidative stress and Parp‐1
network: a new target for neuroprotective effects of tetracyclines? J Physiol. 586, 2427‐
8.
Packer L and Cadenas E. (2011). Lipoic acid: energy metabolism and redox regulation of
transcription and cell signaling. J Clin Biochem Nutr. 48, 26‐32.
Packer L, Witt EH and Tritschler HJ. (1995). alpha‐Lipoic acid as a biological antioxidant. Free
Radic Biol Med. 19, 227‐50.
Padmalayam I, Hasham S, Saxena U and Pillarisetti S. (2009). Lipoic acid synthase (LASY): a
novel role in inflammation, mitochondrial function, and insulin resistance. Diabetes. 58,
600‐8.
Park HJ, DiNatale DA, Chung MY, Park YK, Lee JY, Koo SI, O'Connor M, Manautou JE and
Bruno RS. (2011). Green tea extract attenuates hepatic steatosis by decreasing adipose
lipogenesis and enhancing hepatic antioxidant defenses in ob/ob mice. J Nutr Biochem.
22, 393‐400.
Park K and Lee JH. (2008). Protective effects of resveratrol on UVB‐irradiated HaCaT cells
through attenuation of the caspase pathway. Oncol Rep. 19, 413‐7.
Park KG, Min AK, Koh EH, Kim HS, Kim MO, Park HS, Kim YD, Yoon TS, Jang BK, Hwang JS,
Kim JB, Choi HS, Park JY, Lee IK and Lee KU. (2008). Alpha‐lipoic acid decreases hepatic
Capítulo 5 Discusión General Chapter 5 General Discussion
393
lipogenesis through adenosine monophosphate‐activated protein kinase (AMPK)‐
dependent and AMPK‐independent pathways. Hepatology. 48, 1477‐86.
Patel MS and Packer L (eds.) 2008. Lipoic Acid: Energy production, anrioxidant activity and
health effects, Boca Raton: CRC Press.
Perez‐Carreras M, Del Hoyo P, Martin MA, Rubio JC, Martin A, Castellano G, Colina F,
Arenas J and Solis‐Herruzo JA. (2003). Defective hepatic mitochondrial respiratory chain
in patients with nonalcoholic steatohepatitis. Hepatology. 38, 999‐1007.
Perez‐Echarri N, Perez‐Matute P, Marcos‐Gomez B, Marti A, Martinez JA and Moreno‐Aliaga
MJ. (2009). Down‐regulation in muscle and liver lipogenic genes: EPA ethyl ester
treatment in lean and overweight (high‐fat‐fed) rats. J Nutr Biochem. 20, 705‐14.
Perez‐Matute P, Martinez JA, Marti A and Moreno‐Aliaga MJ. (2007). Linoleic acid
decreases leptin and adiponectin secretion from primary rat adipocytes in the presence
of insulin. Lipids. 42, 913‐20.
Poh ZX and Goh KP. (2009). A current update on the use of alpha lipoic acid in the
management of type 2 diabetes mellitus. Endocr Metab Immune Disord Drug Targets. 9,
392‐8.
Ponugoti B, Kim DH, Xiao Z, Smith Z, Miao J, Zang M, Wu SY, Chiang CM, Veenstra TD and
Kemper JK. (2010). Sirt1 deacetylates and inhibits SREBP‐1C activity in regulation of
hepatic lipid metabolism. J Biol Chem. 285, 33959‐70.
Prieto‐Hontoria PL, Pérez‐Matute P., Fernández‐Galilea M., Martínez J.A., Moreno‐Aliaga
M.J.. (2009). Lipoic acid prevents body weight gain induced by a high fat diet in rats:
Effects on intestinal sugar transport. Journal of Physiology and Biochemestry. 65, 43‐50.
Raffaella C, Francesca B, Italia F, Marina P, Giovanna L and Susanna I. (2008). Alterations in
hepatic mitochondrial compartment in a model of obesity and insulin resistance. Obesity
(Silver Spring). 16, 958‐64.
Ratnam DV, Ankola DD, Bhardwaj V, Sahana DK and Kumar MN. (2006). Role of antioxidants
in prophylaxis and therapy: A pharmaceutical perspective. J Control Release. 113, 189‐
207.
Rector RS, Thyfault JP, Uptergrove GM, Morris EM, Naples SP, Borengasser SJ, Mikus CR,
Laye MJ, Laughlin MH, Booth FW and Ibdah JA. (2010). Mitochondrial dysfunction
precedes insulin resistance and hepatic steatosis and contributes to the natural history
of non‐alcoholic fatty liver disease in an obese rodent model. J Hepatol. 52, 727‐36.
Capítulo 5 Discusión General Chapter 5 General Discussion
394
Robb EL, Page MM, Wiens BE and Stuart JA. (2008a). Molecular mechanisms of oxidative
stress resistance induced by resveratrol: Specific and progressive induction of MnSOD.
Biochem Biophys Res Commun. 367, 406‐12.
Robb EL, Winkelmolen L, Visanji N, Brotchie J and Stuart JA. (2008b). Dietary resveratrol
administration increases MnSOD expression and activity in mouse brain. Biochem
Biophys Res Commun. 372, 254‐9.
Rubiolo JA, Mithieux G and Vega FV. (2008). Resveratrol protects primary rat hepatocytes
against oxidative stress damage: activation of the Nrf2 transcription factor and
augmented activities of antioxidant enzymes. Eur J Pharmacol. 591, 66‐72.
Rubiolo JA and Vega FV. (2008). Resveratrol protects primary rat hepatocytes against
necrosis induced by reactive oxygen species. Biomed Pharmacother. 62, 606‐12.
Sadi G, Yilmaz O and Guray T. (2008). Effect of vitamin C and lipoic acid on streptozotocin‐
induced diabetes gene expression: mRNA and protein expressions of Cu‐Zn SOD and
catalase. Mol Cell Biochem. 309, 109‐16.
Schonheit K, Gille L and Nohl H. (1995). Effect of alpha‐lipoic acid and dihydrolipoic acid on
ischemia/reperfusion injury of the heart and heart mitochondria. Biochim Biophys Acta.
1271, 335‐42.
Schug TT and Li X. (2011). Sirtuin 1 in lipid metabolism and obesity. Ann Med. 43, 198‐211.
Schwer B, North BJ, Frye RA, Ott M and Verdin E. (2002). The human silent information
regulator (Sir)2 homologue hSirt3 is a mitochondrial nicotinamide adenine dinucleotide‐
dependent deacetylase. J Cell Biol. 158, 647‐57.
Serviddio G, Bellanti F, Vendemiale G and Altomare E. (2011). Mitochondrial dysfunction in
nonalcoholic steatohepatitis. Expert Rev Gastroenterol Hepatol. 5, 233‐44.
Shao D, Liu Y, Liu X, Zhu L, Cui Y, Cui A, Qiao A, Kong X, Chen Q, Gupta N, Fang F and Chang
Y. (2010). PGC‐1 beta‐regulated mitochondrial biogenesis and function in myotubes is
mediated by NRF‐1 and ERR alpha. Mitochondrion. 10, 516‐27.
Shen W, Hao J, Tian C, Ren J, Yang L, Li X, Luo C, Cotma CW and Liu J. (2008). A combination
of nutriments improves mitochondrial biogenesis and function in skeletal muscle of type
2 diabetic Goto‐Kakizaki rats. PLoS ONE. 3, e2328.
Song KH, Lee WJ, Koh JM, Kim HS, Youn JY, Park HS, Koh EH, Kim MS, Youn JH, Lee KU and
Park JY. (2005). alpha‐Lipoic acid prevents diabetes mellitus in diabetes‐prone obese
rats. Biochem Biophys Res Commun. 326, 197‐202.
Capítulo 5 Discusión General Chapter 5 General Discussion
395
Song S, Attia RR, Connaughton S, Niesen MI, Ness GC, Elam MB, Hori RT, Cook GA and Park
EA. (2010). Peroxisome proliferator activated receptor alpha (PPARalpha) and PPAR
gamma coactivator (PGC‐1alpha) induce carnitine palmitoyltransferase IA (CPT‐1A) via
independent gene elements. Mol Cell Endocrinol. 325, 54‐63.
Sonoda J, Mehl IR, Chong LW, Nofsinger RR and Evans RM. (2007). PGC‐1beta controls
mitochondrial metabolism to modulate circadian activity, adaptive thermogenesis, and
hepatic steatosis. Proc Natl Acad Sci U S A. 104, 5223‐8.
Sookoian S, Rosselli MS, Gemma C, Burgueno AL, Fernandez Gianotti T, Castano GO and
Pirola CJ. (2010). Epigenetic regulation of insulin resistance in nonalcoholic fatty liver
disease: impact of liver methylation of the peroxisome proliferator‐activated receptor
gamma coactivator 1alpha promoter. Hepatology. 52, 1992‐2000.
Srivastava S, Diaz F, Iommarini L, Aure K, Lombes A and Moraes CT. (2009). PGC‐
1alpha/beta induced expression partially compensates for respiratory chain defects in
cells from patients with mitochondrial disorders. Hum Mol Genet. 18, 1805‐12.
Sudheesh NP, Ajith TA, Janardhanan KK and Krishnan CV. (2009). Palladium alpha‐lipoic acid
complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory
complexes I‐IV in the heart of aged rats. Food Chem Toxicol. 47, 2124‐8.
Sudheesh NP, Ajith TA, Janardhanan KK and Krishnan CV. (2010). Effect of POLY‐MVA, a
palladium alpha‐lipoic acid complex formulation against declined mitochondrial
antioxidant status in the myocardium of aged rats. Food Chem Toxicol. 48, 1858‐62.
Sundaresan NR, Gupta M, Kim G, Rajamohan SB, Isbatan A and Gupta MP. (2009). Sirt3
blocks the cardiac hypertrophic response by augmenting Foxo3a‐dependent antioxidant
defense mechanisms in mice. J Clin Invest. 119, 2758‐71.
Vanni E, Bugianesi E, Kotronen A, De Minicis S, Yki‐Jarvinen H and Svegliati‐Baroni G. (2010).
From the metabolic syndrome to NAFLD or vice versa? Dig Liver Dis. 42, 320‐30.
Wang Y, Li X, Guo Y, Chan L and Guan X. (2010). alpha‐Lipoic acid increases energy
expenditure by enhancing adenosine monophosphate‐activated protein kinase‐
peroxisome proliferator‐activated receptor‐gamma coactivator‐1alpha signaling in the
skeletal muscle of aged mice. Metabolism. 59, 967‐76.
Wilson JX. (2009). Mechanism of action of vitamin C in sepsis: ascorbate modulates redox
signaling in endothelium. Biofactors. 35, 5‐13.
Yogeeta SK, Raghavendran HR, Gnanapragasam A, Subhashini R and Devaki T. (2006).
Ferulic acid with ascorbic acid synergistically extenuates the mitochondrial dysfunction
Capítulo 5 Discusión General Chapter 5 General Discussion
396
during beta‐adrenergic catecholamine induced cardiotoxicity in rats. Chem Biol Interact.
163, 160‐9.
Yu XX, Murray SF, Pandey SK, Booten SL, Bao D, Song XZ, Kelly S, Chen S, McKay R, Monia BP
and Bhanot S. (2005). Antisense oligonucleotide reduction of DGAT2 expression
improves hepatic steatosis and hyperlipidemia in obese mice. Hepatology. 42, 362‐71.
Zhang D, Liu ZX, Choi CS, Tian L, Kibbey R, Dong J, Cline GW, Wood PA and Shulman GI.
(2007). Mitochondrial dysfunction due to long‐chain Acyl‐CoA dehydrogenase deficiency
causes hepatic steatosis and hepatic insulin resistance. Proc Natl Acad Sci U S A. 104,
17075‐80.
Zhang R, Chen HZ, Liu JJ, Jia YY, Zhang ZQ, Yang RF, Zhang Y, Xu J, Wei YS, Liu DP and Liang
CC. (2010). Sirt1 suppresses activator protein‐1 transcriptional activity and
cyclooxygenase‐2 expression in macrophages. J Biol Chem. 285, 7097‐110.
Zhu XX, Liu Q, Wang MM, Liang MR, Yang X, Xu X, Zou HJ and Qiu JH. (2011). Activation of
Sirt1 by Resveratrol Inhibits TNF‐alpha Induced Inflammation in Fibroblasts. PLoS ONE. 6.
CAPÍTULO 6/CHAPTER 6
Conclusiones/Conclusions
Chapter 6 Conclusions Capítulo 6 Conclusiones
399
CONCLUSIONES
1. La incubación de mitocondrias aisladas de hígado de rata con vitamina C y resveratrol
indujo una disminución en la producción de ROS (O2*‐ y H2O2). En el caso de la
vitamina C, dicha disminución parece mediada por el aumento en la actividad de las
principales defensas antioxidantes enzimáticas (Sod2 y mtGpx). Sin embargo, el
resveratrol no indujo cambios importantes en la actividad de dichas defensas
antioxidantes. Por otro lado, estos antioxidantes no indujeron cambios significativos
en la cadena de transporte de electrones, si bien ambas moléculas disminuyeron el
ratio P/O, indicador de la eficiencia de la cadena transportadora de electrones.
2. El tratamiento con ácido lipoico de mitocondrias aisladas de hígado de rata presentó
efectos pro‐oxidantes al inducir un aumento en la producción de H2O2 y una
inhibición de la actividad de la glutatión peroxidasa. Además, el ácido lipoico provocó
un desacoplamiento de la cadena de transporte electrónico asociado a una
disminución del consumo de oxígeno en el estado 3 y una bajada del ratio P/O.
3. El ácido lipoico, en contraposición con lo observado in vitro, revirtió el aumento del
estrés oxidativo y el daño oxidativo en el compartimento mitocondrial hepático
asociado a la evolución de la NAFLD a NASH inducida por una dieta alta en grasa.
Principalmente, mediante la estimulación de las defensas antioxidantes
mitocondriales (Sod2, mtGpx y ratio GSH:GSSG).
4. La medida de las defensas antioxidantes eritrocitarias podría ser un adecuado
biomarcador, mínimamente invasivo, del estado antioxidante en el compartimento
hepático mitocondrial. En consecuencia, también de la evolución de la enfermedad
hepática no alcohólica inducida por la ingesta de una dieta alta en grasa. De hecho,
se encontró una estrecha asociación entre las defensas antioxidantes en ambos
tejidos, eritrocitos e hígado, así como una relación inversa con la acumulación de
grasa en el hígado y el daño en el mtDNA.
5. La suplementación de un dieta control y alta en grasa con ácido lipoico aumentó las
principales defensas antioxidantes en eritrocitos y en el compartimento hepático
Capítulo 6 Conclusiones Chapter 6 Conclusions
400
mitocondrial. Los efectos estimulantes del ácido lipoico sobre el ratio GSH:GSSG y la
actividad glutatión peroxidasa fueron de intensidad mayor en los animales
alimentados con una dieta alta en grasa en comparación con los alimentados con
dieta control.
6. La suplementación de una dieta alta en grasa con ácido lipoico fue capaz de prevenir
la esteatosis hepática en un modelo animal de obesidad inducida por la dieta. Esta
acción puede atribuirse a la disminución en la expresión de genes lipogénicos,
especialmente Dgat2, así como al aumento de genes implicados en la β‐oxidación de
ácidos grasos (Acox1 y Acdl). Además, el ácido lipoico redujo el índice HOMA,
marcador de resistencia a la insulina.
7. El ácido lipoico disminuyó la eficiencia metabólica al reducir la actividad de la cadena
de transporte de electrones, la producción de ATP y la expresión génica de Ucp2, a
pesar de aumentar la actividad de las principales enzimas del ciclo de Krebs. Estos
resultados parecen sugerir que la inhibición de la actividad de la cadena de
transporte de electrones inducida por este antioxidante sea un mecanismo
compensatorio frente al exceso de la ingesta energética.
8. El ácido lipoico estimuló la biogénesis mitocondrial en el hígado asociada a una
disminución en la masa mitocondrial, lo que sugiere que este antioxidante produce
un aumento en el número y la eficiencia de las mitocondrias. Consecuentemente, los
animales del grupo suplementado con ácido lipoico mostraron niveles elevados en la
expresión de los principales genes implicados en la biogénesis mitocondrial (Pgc‐1α,
Pgc1β y Nrf1), siendo especialmente relevante el aumento observado en Pgc‐1β.
9. La suplementación de una dieta alta en grasa con ácido lipoico indujo un aumento en
los niveles de proteína de Sirt1 y Sirt3 en hígado. Además, dichos niveles se
correlacionaron con un aumento en la desacetilación de Pgc1β y Foxo3a,
respectivamente. Estos datos sugieren que los efectos beneficiosos del ácido lipoico
sobre las defensas antioxidantes, la biogénesis y función mitocondrial así como sobre
la homeostasis energética esten mediados por la acción del antioxidante sobre las
sirtuinas.
Chapter 6 Conclusions Capítulo 6 Conclusiones
401
CONCLUSION GENERAL
La vitamina C, el resveratrol y el ácido lipoico son capaces de modular la función
mitocondrial y el balance oxidativo en mitocondrias hepáticas a través de diferentes
mecanismos. En particular, el tratamiento de animales de experimentación con ácido
lipoico fue capaz de prevenir el desarrollo de la esteatosis hepática inducida por una
dieta alta en grasa. Este efecto se debió, fundamentalmente, a su acción beneficiosa
sobre algunos de los principales factores implicados en la evolución de la enfermedad
hepática no alcohólica, como son, la resistencia a la insulina, el estrés oxidativo y la
disfunción mitocondrial.
Chapter 6 Conclusions Capítulo 6 Conclusiones
CONCLUSIONS
1. Vitamin C and resveratrol treatment of isolated rat liver mitochondria reduces ROS
production (O2*‐ and H2O2). The effects of vitamin C on ROS production could be
mediated by an increase in mitochondrial antioxidant defenses (Sod2 y mtGpx).
However, resveratrol did not induce important changes on antioxidant enzymes.
Moreover, both antioxidants did not produced significant changes in the activity of
electron transport chain, while both decreased P/O ratio.
2. The treatment of rat liver mitochondria with lipoic acid presents pro‐oxidant effects
by stimulating H2O2 production and reducing mtGpx activity. Moreover, lipoic acid
induced an uncoupling of electron transport chain linked to a decrease in oxygen
consumption in respiratory state 3 and a fall in the P/O ratio.
3. Dietary supplementation with lipoic acid, in contrast to the in in vitro findings,
reversed the increase of oxidative stress and oxidative damage linked to the
evolution of NAFLD to NASH in mitochondrial liver compartment. This condition may
be associated to the increase of some mitochondrial antioxidant defenses (Sod2,
mtGpx y GSH:GSSG ratio).
4. The assessment of antioxidant defences in erythrocytes could be used as good
surrogate marker, minimally invasive, of the mitochondrial antioxidant status in the
liver, and consequently, it could be good predictor of the development of NAFLD
after a high fat diet. This outcome could be attributed to an association between
antioxidant defences in erythrocytes and liver. Furthermore, an inverse relationship
of erythrocyte antioxidant defences and lipid accumulation in the liver and oxidative
damage in mtDNA was also observed.
5. LA supplementation of a standard and high fat diet induced an increase of main
antioxidant defenses in erythrocytes and also in the liver mitochondria. The
stimulatory effects of lipoic acid in GSH:GSSG ratio and mtGpx activity were higher in
animals fed with a high fat diet than in rats fed with standard diet.
Capítulo 6 Conclusiones Chapter 6Conclusions
404
6. Lipoic acid supplementation of high‐fat diet was able to prevent liver steatosis in an
animal model of diet induced obesity. This beneficial effect may be due to a
reduction in mRNA levels of lipogenic genes, especially Dgat2, as well as an increase
in the expression of β‐oxidation related genes (Acox1 y Acdl) induced by lipoic acid in
the liver. Moreover, lipoic acid supplementation reduced HOMA index, a marker of
insulin resistance.
7. Lipoic acid diminished energy efficiency by the decrease of electron transport chain
activity, ATP production and gene expression of Ucp2, despite increasing the activity
of the main enzymes of Krebs cycle. These results suggest that the inhibition of
electron transport chain activity induced by this antioxidant is a compensatory
mechanism against increase in energy intake.
8. Lipoic acid stimulates mitochondrial biogenesis in the liver associated with a
reduction of mitochondrial mass, which suggest that this antioxidant induced an
increase in mitochondrial number and efficiency. Consequently, animals fed with a
lipoic acid supplemented diet showed higher mRNA levels of genes involved in
transcriptional control of mitochondrial biogenesis (Pgc‐1α, Pgc1β y Nrf1),
particularly of Pgc‐1β.
9. Lipoic acid supplementation of HFD stimulates Sirt1 and Sirt3 protein content in the
liver, which was correlated with an increase of Pgc1β and Foxo3a deacetylation
levels, respectively. These results may suggest that the beneficial effects of lipoic acid
on antioxidant defenses, mitochondrial function and biogenesis and also in energy
homeostasis could be mediated through the stimulation of sirtuinas induced by this
antioxidant.
Chapter 6 Conclusions Capítulo 6 Conclusiones
GENERAL CONCLUSION
Vitamin C, resveratrol and lipoic acid is able to regulate mitochondrial function and
oxidative balance in the liver by different mechanisms. Particularly, lipoic acid treatment
is able to prevent the onset of hepatic steatosis induced by a high fat diet intake. These
effects could be explained by beneficial actions on main factors involved in the evolution
of non‐alcoholic fatty liver disease such as insulin resistance, oxidative stress and
mitochondrial dysfunction.
CAPÍTULO 7/CHAPTER 7
Resumen /Summary
Chapter 7 Summary Capítulo7 Resumen
Non‐alcoholic steatosis is an important hepatic complication of obesity linked to mitochondrial
dysfunction and oxidative stress. Lipoic acid has been reported to have beneficial effects on
mitochondrial function and to attenuate oxidative stress. In this PhD project, I was analyzed
the potential protective effect of lipoic acid supplementation against the development of non‐
alcoholic steatosis associated with a long‐term high‐fat diet feeding and the potential
mechanisms involved in these effects. Particularly, I researched the effects of LA on the
modulation of mitochondrial defenses through the sirtuin pathway. To achieve these
objectives, male Wistar rats were fed a standard diet (C, n=10), a high‐fat diet (OB, n=10) and a
high‐fat diet supplemented with LA (OLIP, n=10). A group pair‐fed to the latter group (PFO,
n=6) was also included.
Lipoic acid prevented hepatic triglyceride accumulation and liver damage in rats fed on a high‐
fat diet (‐68±11.3% vs obese group), through the modulation of genes involved in lipogenesis
and mitochondrial β‐oxidation, and by improving insulin sensitivity. Moreover, this molecule
showed an inhibitory action on electron transport chain complexes activities (P<0.01‐P<0.001)
and ATP synthesis (P<0.05), and reduced significantly energy efficiency. By contrast, lipoic acid
induced an increase in mitochondrial copy number and in Ucp2 gene expression (P<0.001 vs
obese). Moreover, LA prevented liver oxidative damage (P<0.01) through the inhibition of
hydroperoxide production (P<0.001) and the stimulation of mitochondrial antioxidant
defenses. LA treatment up‐regulated manganese superoxide dismutase (60.6%) and
glutathione peroxidase (100.2%) activities, and increased the GSH:GSSG ratio and Ucp2 mRNA
levels (P<0.001‐ P<0.01). Moreover, this molecule reduced oxidative damage in mitochondrial
DNA and increased mitochondrial copy number (P<0.001‐ P<0.01). LA treatment decreased the
acetylation levels of Foxo3a and Pgc1β (P<0.001‐ P<0.01) through the stimulation of Sirt3 and
Sirt1 (P<0.001).
Summary up, our results demonstrate that the beneficial effects of LA supplementation on
hepatic steatosis could be mediated by its ability to restore the oxidative balance by increasing
antioxidant defenses through the deacetylation of Foxo3a and Pgc1β by Sirt1 and Sirt3. Finally,
the novelty and importance of this study is the finding of the role of lipoic acid modulating
some of the mitochondrial processes involved in energy homeostasis. The reduction in
mitochondrial energy efficiency could also explain, at least in part, the beneficial effects of
lipoic acid not only in fatty liver, but also in preventing excessive body weight gain.
- Anexo 1: Valdecantos, P.; Pérez-Matute, P.; Quintero, P. y Alfredo Martínez, J.
“Vitamin C, resveratrol and lipoic acid actions on isolated rat liver mitochondria: all
antioxidants but different”. Redox Report 2010, 15 (5), 207-216. DOI:
10.1179/135100010X12826446921464
- Anexo 2: M. Pilar Valdecantos, Patricia Pérez-Matute, Pedro Luis Prieto-Hontoria,
Elena Sánchez-Campayo, María Jesús Moreno-Aliaga, J. Alfredo Martínez. Erythrocyte
antioxidant defenses as a potential biomarker of liver mitochondrial status in different
oxidative conditions. Biomarkers, Volume 16, Number 8 (December 2011), pp. 670-678,
http://ejournals.ebsco.com/direct.asp?ArticleID=426DA5E66D1C1B4155D8
DOI: 10.3109/1354750X.2011.625504
- Anexo 3: M. Pilar Valdecantos, Patricia Pérez-Matute, Pedro González-Muniesa, Pedro
L. Prieto-Hontoria, María J. Moreno-Aliaga, J. Alfredo Martínez, “Lipoic acid
administration prevents nonalcoholic steatosis linked to long-term high-fat feeding by
modulating mitochondrial function”, The Journal of Nutritional Biochemistry,
December 2012, 23 (12), 1676-1684. DOI:
http://dx.doi.org/10.1016/j.jnutbio.2011.11.011.
http://www.sciencedirect.com/science/article/pii/S0955286311003202
- Anexo 4: Valdecantos, M. P., Pérez-Matute, P., González-Muniesa, P., Prieto-Hontoria,
P. L., Moreno-Aliaga, M. J. and Martínez, J. A. (2012), Lipoic Acid Improves
Mitochondrial Function in Nonalcoholic Steatosis Through the Stimulation of Sirtuin 1
and Sirtuin 3. Obesity, 20: 1974–1983. DOI: 10.1038/oby.2012.32
http://onlinelibrary.wiley.com/doi/10.1038/oby.2012.32/abstract
- Anexo 5: Martínez, JA, et al. “Obesidad y estrés oxidante: papel de la suplementación
con antioxidantes de la dieta”. Rev Invest Clin 2009; 61 (2), 127-139.
http://www.imbiomed.com.mx/1/1/articulos.php?id_revista=2&id_ejemplar=5814