![Page 1: Identification of Mycobacterium marinum in sea-urchin granulomas](https://reader036.vdocuments.co/reader036/viewer/2022082718/575023d41a28ab877eabdad0/html5/thumbnails/1.jpg)
British Journal of Dermatology 2001; 145: 114±116.
Identification of Mycobacterium marinum in sea-urchingranulomas
C.DE LA TORRE, A.VEGA,* A.CARRACEDO² AND J.TORIBIO³
Service of Dermatology, Complejo Hospitalario de Pontevedra, C/Loureiro Crespo s/n, 36001 Pontevedra, Spain
*Unidad de Medicina Molecular, SERGAS, Santiago, Spain
²Instituto de Medicina Legal and ³Departamento de DermatologiÂa, Universidad de Santiago, Santiago, Spain
Accepted for publication 23 February 2001
Summary Background Sea-urchin granuloma is a chronic granulomatous reaction arising after injury withsea-urchin spines. Classified as an allergic foreign-body type of granuloma, it is believed to be a
delayed-type reaction to an as yet unidentified antigen. In a clinicopathological study, 50 biopsyspecimens from 35 patients diagnosed as having sea-urchin granuloma caused by Paracentrotus
lividus, we found different inflammatory patterns that in some cases suggested a mycobacterial
infection.Objectives To investigate and identify mycobacterial DNA in formalin-fixed and paraffin-embedded
skin biopsy specimens diagnosed as sea-urchin granulomas.
Methods A search combining polymerase chain reaction amplification using Mycobacteriumgenus-specific primers, and subsequent restriction enzyme analysis enabling identification to the
species level, was performed in 41 samples.
Results Amplification of a 924-bp DNA fragment encoding mycobacterial 16S rRNA gene waspositive in eight biopsy specimens from seven patients (21%). M. marinum-specific restriction
patterns were identified in three samples.
Conclusions Although further controlled studies are necessary, from these data it would appearthat myobacteria may play a pathogenic role in some cases of sea-urchin granuloma.
Key words: echinoderm dermatitis, marine injuries, mycobacteria, Mycobacterium marinum,Paracentrotus lividus, polymerase chain reaction, sea-urchin granuloma
Sea-urchins can produce lesions either with the spines
or the pedicellariae. Two types of sea-urchin reactionshave been described: immediate and delayed reactions.
Delayed reactions may be nodular or diffuse and are
designated `sea-urchin granulomas'.1±5 The sea-urchinParacentrotus lividus, common in Mediterranean and
Atlantic coastal waters, is the main culprit in thereported cases of sea-urchin granuloma.6±8 To date,
investigations have failed to demonstrate the causative
agents able to induce this granulomatous reaction.
Materials and methods
A histopathological study was carried out using 50
biopsy specimens from 35 patients. Using archival
material from this study, polymerase chain reaction
(PCR) was performed in 41 formalin-fixed and paraffin-embedded skin biopsy specimens. Tissue was not
available in nine instances, but PCR was performed at
least once in every patient. We used PCR withMycobacterium genus-specific primers encoding small
subunit rRNA sequences, and digestion of the amplifiedfragment with restriction enzymes (BanI and ApaI) that
yielded a specific pattern enabling identification of
M. marinum.9,10
Specimens were cut to 10 mm and deparaffinized
with 1 mL xylene for 1±2 h and then centrifuged for
15 min. Measures were installed to avoid cross-contamination, including the use of dedicated labora-
tory areas. Only one item from a case was analysed in
the laboratory at a time, and reagent blanks andnegative controls were used through the process. The
samples were washed in an ethanol series (100%, 80%,
114 q 2001 British Association of Dermatologists
Correspondence: Carlos De la Torre, Plaza AmeÂrica 3±58 D, 36211
Vigo, Spain. E-mail: [email protected]
![Page 2: Identification of Mycobacterium marinum in sea-urchin granulomas](https://reader036.vdocuments.co/reader036/viewer/2022082718/575023d41a28ab877eabdad0/html5/thumbnails/2.jpg)
M. MARINUM IN SEA-URCHIN GRANULOMAS 115
q 2001 British Association of Dermatologists, British Journal of Dermatology, 145, 114±116
70%). The pellet was dried and resuspended in 100 mL
digestion buffer (200 mg mL21 proteinase K,50 mmol L21 Tris hydrochloride pH 8´5, 1 mmol L21
ethylenediamine tetraacetic acid, 0´5% Tween 20) at
56 8C for 2 h and then the proteinase K inactivated byboiling for 10 min11 Two oligonucleotide primers were
used to amplify a fragment of 924 bp from the 16SrRNA gene of Mycobacterium9 (P1, GCGAACGGGT-
GAGTAACACG; P2, TGCACACAGGCCACAAGGGA).
DNA amplification was carried out in a 25-mL volumewith 5±25 ng template DNA, 10 mmol L21 Tris
hydrochloride pH 8´3, 50 mmol L21 KCl, 1´5 mmol L21
MgCl2, 200 mmol L21 of each deoxyribonucleosidetriphosphate, 10 pmol of each primer and 1´25 U of
Taq polymerase (Life Technologies, Rockville, MD,
U.S.A.). The reactions were carried out in a thermalcycler (Progene, Techne, Princeton, NJ, U.S.A.), and
consisted of 30 cycles with three steps of denaturation
(95 8C, 30 s), annealing (55 8C, 30 s) and extension
(72 8C, 45 s). The amplified DNA products weredigested by restriction enzymes ApaI and BanI (Life
Technologies), and the digested samples were analysed
by electrophoresis on polyacrylamide gels (PhastGels,APB, Uppsala, Sweden) and stained with silver nitrate.
All the positive samples were analysed at least three
times each, with consistent results.
Results
The cohort consisted of 35 patients (31 male and four
female) diagnosed as having sea-urchin granulomas
(Fig. 1). The patients had a median age of 35 years(range 14±60), and a median latency time from the
time of injury of 7´5 months. Half of these patients
were involved in fishing activities, and 50% of thesewere divers dedicated to commercial harvesting of
sea-urchins.
Fifty biopsy specimens were available for histologicalstudy. Several inflammatory patterns were noted. In
70% there was a granulomatous pattern, mainly of
sarcoidal (n � 13; 26%) or foreign-body (n � 10; 20%)type. Other granulomatous patterns identified were
tuberculoid (n � 2), necrobiotic (n � 6) and suppura-tive granulomas (n � 4). In 30% the predominant
pattern was non-granulomatous with features of
chronic and suppurative dermatitis. Acid-fast bacilliwere not identified using Ziehl±Neelsen stains. Skin
biopsy specimens were cultured in only 11 instances,
none of which gave positive isolates of mycobacteria.A PCR-amplified DNA fragment of 924 bp, encoding
mycobacterial 16S rRNA, was obtained in eight
biopsies from seven patients. Digestion yielded threefragments (677 bp, 132 bp, 115 bp) specific for
M. marinum9 in three of these samples (Fig. 2). The
remaining patterns, with two fragments (792 bp and132 bp) were not specific for M. marinum, suggesting
the possibility of a mutation, subspecies or other non-
identified mycobacterial species. Among the positiveresults, four cases showed predominantly granuloma-
tous inflammation. Statistical analysis (x2-tests)
showed no correlation between positivity and patternof inflammation.
Discussion
The main constituent of sea-urchin spines is calcium
carbonate, which is considered immunologically inert.It has, therefore, been postulated that a proteinaceous
compound generated by the spine epithelium, a
Figure 1. Sea-urchin granuloma with papular and inflammatory
lesions involving the dorsum of the fingers.
Figure 2. Polymerase chain reaction from cutaneous samples of sea-
urchin granuloma. Left: amplified 924-bp DNA fragment encoding
Mycobacterium 16S rRNA. Right: restriction enzyme analysis withApaI. Lanes 1, 2 and 6 show a pattern specific for M. marinum.
![Page 3: Identification of Mycobacterium marinum in sea-urchin granulomas](https://reader036.vdocuments.co/reader036/viewer/2022082718/575023d41a28ab877eabdad0/html5/thumbnails/3.jpg)
116 C.DE LA TORRE et al.
q 2001 British Association of Dermatologists, British Journal of Dermatology, 145, 114±116
substance that can enter the wound, either produced
by the pedicellariae or adherent to the spine (sand,slime, algae, etc.) could be the agent responsible for
sensitization. Usually no microorganisms, sarcoidal
diathesis or metals likely to produce granulomas havebeen detected; the spine silica content is about 0´55%,
but no polarized material has been identified in
biopsies.5,6,12 The first description13 suggested papulo-necrotic tuberculide, and although a mycobacterial
infection was sought,7 acid-fast bacilli were detected
in only one case14 in which the authors proposedthat echinoderm granuloma could be a new myco-
bacterial infection. The reaction was later defined as
sarcoidal.8 We cannot find any reports in thedermatological or rheumatological literature docu-
menting a systematic search for mycobacteria in
cases of this condition.As M. marinum is not a commensal, and contamina-
tion is unlikely, its identification favours a pathogenic
role in some cases of sea-urchin granuloma. As thiswas not identified in all cases, it is likely that several
different aetiopathogenic mechanisms may be involvedin the granulomatous lesions provoked by punctures
with sea-urchin spines. The spines can occasionally
harbour M. marinum, and Mycobacterium is probablyone of the implicated agents. Although this is a
tentative and preliminary conclusion we think that it
may have pathogenic and therapeutic implications tobe investigated further.
In addressing future studies on this topic, it should
be remembered that the diagnosis of cutaneousM. marinum infection is frequently presumptive, as
detection by conventional methods is difficult,15 and
also that several Mycobacterium species that arepathogenic to humans can infect aquatic species.9
References
1 Rocha G, Fraga S. Sea urchin granuloma of the skin. Arch
Dermatol 1962; 85: 146±8.
2 Warin AP. Sea-urchin granuloma. Clin Exp Dermatol 1977; 2:
405±7.
3 Fisher AA, Orris WL. Aquatic contact dermatitis. Cutis 1973; 12:
687±95.
4 Haneke E, Kolsch I. Seeigelgranulome. Hautarzt 1980; 31:
159±60.
5 Baden HP. Injuries from sea urchins. Clin Dermatol 1987; 5:112±17.
6 Anonymous. On the rocks. (Editorial) Lancet 1974; i: 1091±2.
7 Kinmont PDC. Sea-urchin sarcoidal granuloma. Br J Dermatol
1965; 77: 335±43.
8 Cooper P, Wakefield MC. A sarcoid reaction to injury by sea
urchin spines. J Pathol 1974; 112: 33±6.
9 Talaat AM, Reimschuessel R, Trucksis M. Identification of
mycobacteria infecting fish to the species level using polymerase
chain reaction and restriction enzyme analysis. Vet Microbiol1997; 58: 229±37.
10 Tùnjun T, Welty DB, Jantzen E, Small PL. Differentiation of
Mycobacterium ulcerans, M. marinum, and M. haemophilum:mapping of their relationships to M. tuberculosis by fatty acid
profile analysis, DNA-DNA hybridization, and 16S rRNA gene
sequences analysis. J Clin Microbiol 1998; 36: 918±25.
11 Sobrido MJ, Barros F, Lema M et al. Assessing microsatellite
instability with semiautomated fluorescent technology. Applica-
tion to the analysis of primary brain tumours. Electrophoresis2000; 21: 1471±7.
12 Asada M, Komura J, Hosokawa H et al. A case of delayedhypersensitivity reaction following a sea urchin sting. Dermato-
logica 1990; 180: 99±101.
13 Gate J, Cuilleret P, Chanial G, Bouquin H. LeÂsions papulo-neÂcro-tiques aÁ reÂaction histologique tuberculoiÈde dues aÁ l'inclusion
d'eÂpines d'oursins. Bull Soc Fr Dermatol Syphiligr 1936; 43: 937±8.
14 Moynahan EJ, Montgomery PR. Echinoderm granuloma: a skin
lesion resulting from injury by the spines of sea-urchins
inhabitating temperate waters? A new mycobacterial infection.
Br J Clin Pract 1968; 22: 265±9.
15 Ang P, Rattana-Apiromyakij N, Goh C-L. Restrospective study of
Mycobacterium marinum skin infections. Int J Dermatol 2000; 39:343±7.